section12_ak

section12_ak - MIT Department of Biology 7.014 Introductory...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
MIT Department of Biology 7.014 Introductory Biology, Spring 2005 Recitation Section 12 Answer Key March 16-17, 2005 Molecular Biology Review a b c A. Representations d e 5’ 3’ 3’ 5’ 5’AACGCAAGGCACTTCACCAGGCTTGTATATATAAATGTCGTGATGCTTCTATGCCAAAGTAAAAGGCAACACTTGAAGATTTCGTTGTAGGCC3’ ± f 3’TT GCGTTCCGTGAAGTGGTCCGAACATATATATTTACAGCACTACGAACATACGGTTTCATTTTCCGTTGTGAACTTCTAAAGCAACATCCGG5’ P A + A + N - P N + P XYZ + O + g P A + A + N + P N + P + O + h P A + A - N + P N + P + O + i j XYZ XYZ 1. What molecule is represented in each figure? DNA 2. In figure e, what do vertical lines represent? Hydrogen bonds between bases 3. How do all these representations relate to each other? Figure j shows a nucleotide—building bock of DNA. The base portion of nucleotides are involved in base pairing, and the sugar and the first phosphate get incorporated into the growing DNA chain as depicted in i. 5’ and 3’ carbons of the sugar indicate direction of polymerization. Spacefill view in a. Sequence of bases on two strands in f. Schematic representation of paired strands in e. Double
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 05/02/2009 for the course BIOL 7.014 taught by Professor Walker during the Spring '05 term at MIT.

Page1 / 2

section12_ak - MIT Department of Biology 7.014 Introductory...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online