hms_4445

hms_4445 - Complex traits: what to believe? Joel N....

Info iconThis preview shows pages 1–13. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Complex traits: what to believe? Joel N. Hirschhorn, MD, PhD Children’s Hospital/Harvard Medical School Whitehead/MIT Center for Genome Research Harvard-MIT Division of Health Sciences and Technology HST.512: Genomic Medicine Prof. Joel Hirschhorn SNPs, patterns of variation, and complex traits • Introduction • Common genetic variation and disease • Methods for finding variants for complex traits • Interpreting genetic studies – Association – Linkage – Resequencing What could we learn? SNPs, patterns of variation, and complex traits • Introduction • Common genetic variation and disease • Methods for finding variants for complex traits • Interpreting genetic studies – Association – Linkage – Resequencing • What could we learn? Many common diseases have genetic components... Diseases Bipolar disorder Stroke Heart attack Breast cancer Diabetes Inflammatory bowel disease Prostate cancer Arthritis …as do many quantitative traits... Quantitative Traits Height Blood pressure Insulin secretion Weight Waist-hip ratio Timing of Puberty Bone density …but the genetic architecture is usually complex Gene N Nutrition Environment Environment in utero Etc. Gene 1 Gene 2 Genes Gene 3 . . . Goal: Connect genotypic variation with phenotypic variation Inherited DNA sequence variation Variation in phenotypes ? Associating inherited (DNA) variation with biological variation • Each person’s genome is slightly different • Some differences alter biological function • Which differences matter? How do we know genetics plays a role? Twin studies • Identical (monozygotic) twins are more similar than fraternal twins (dizygotic) • Example: type 2 diabetes – MZ twins: >80% concordant – DZ twins: 30-50% concordant How do we know genetics plays a role? Family studies • Risk to siblings and other relatives is greater than in the general population • Example: type 2 diabetes – Risk to siblings: 30% – Population risk: 5-10% SNPs, patterns of variation, and complex traits • Introduction • Common genetic variation and disease • Methods for finding variants for complex traits • Interpreting genetic studies – Association – Linkage – Resequencing • Approaches for the present and future – Haplotypes and linkage disequilibrium • What could we learn? CCGATCGTACGACACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCATCGTACTGAC TGACTGCATCGTACTGACTGCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCAC CGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACA ATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGTCA GTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACAT TACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACA TCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGT GATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCG CTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACAC ACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGCATCGTACTGACTGTCTAGTCTAAACA GTACTGACTGTCTAGTCTAAACACATCCCAGCATCCATCCATATCGTCATCGTACTGACTGTCTAG...
View Full Document

This note was uploaded on 03/27/2008 for the course HST 512 taught by Professor Ramoni during the Spring '06 term at MIT.

Page1 / 91

hms_4445 - Complex traits: what to believe? Joel N....

This preview shows document pages 1 - 13. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online