ACTIVITY FOUR_TRANSLATION (2).docx - ACTIVITY FOUR...

This preview shows page 1 out of 1 page.

ACTIVITY FOUR: TRANSCRIPTION-TRANSLATION (9/13/18) GROUP MEMBERS: Nathan Germano, Ycied Talavera, Cesily Cirerol, Abraham Sanchez Instructions : Use the following DNA sequences to answer the questions below, if the bottom strand is the template strand. Please work in groups of 2+. If you work by yourself, your assignment will not be graded. 5’- GTTAGATGTGTCCAGGTCTCTTCATGACGT -3’ (Non-Mutated top strand) 3’- CAATCTACACAGGTCCAGAGAAGATTTGCA -5’ (Non-Mutated bottom strand) Mutations change the DNA molecule to the following sequence: 5’-GTTAGATGTGTCCAGGTCTACACATGACGT-3’ (Mutated top strand) 3’-CAATCTACACAGGTCCAGATGTGATTTGCA-5’ (Mutated bottom strand) Questions 1- What is the mRNA strand that was transcribed from the Non-Mutated DNA strand? 5’- GUUAGAUGUGUCCAGGUCUCUUCAUGACGU-3’
2- What is the mRNA strand that was transcribed from the Mutated DNA strand?
3- What is the protein sequence that was obtained from the Non-Mutated mRNA strand?

  • Left Quote Icon

    Student Picture

  • Left Quote Icon

    Student Picture

  • Left Quote Icon

    Student Picture