aplikasi_filogenetik_mol_topikh_23012017.pdf - Aplikasi analisis filogenetika molekuler Topik Hidayat Biologi-UPI Bandung SITH-ITB,23 Januari 2017

aplikasi_filogenetik_mol_topikh_23012017.pdf - Aplikasi...

This preview shows page 1 - 10 out of 35 pages.

Aplikasi analisis filogenetika molekuler Topik Hidayat Biologi-UPI Bandung SITH-ITB,23 Januari 2017 Seminar Analisis Filogenetika Molekuler
Image of page 1
(Bio)systematics Taxonomy and Phylogeny Biodiversity
Image of page 2
(Bio)systematics Phenetic Cladistic/Phylogenetic Molecules Non-molecules Tree reconstruction (Bio)systematics in practice (1) Distance Method Character based Method Parsimony Likelihood Bayesian
Image of page 3
Molecule tree Non-molecule tree Combined tree (Total evidence) (Bio)systematics in practice (2)
Image of page 4
Monophyletic group outgroup plesiomorphic sinapomorphic apomorphic Phylogenetic Classification System (Bio)systematics in practice (3)
Image of page 5
Data: Morphology Anatomy Palynology Microscopy Biochemistry Physiology Ecology Molecular/genetics/Omics
Image of page 6
Types of molecular data? DNA sources: - Nucleus - Chloroplast - Mitochondria Methods: - Restriction - Sequencing Selection of sources and methods are depending on the issues that will be addressed.
Image of page 7
DNA sequences
Image of page 8
Filogenetika Molekuler ? Program komputer : PAUP & MrBayes & Phylip Karakter molekuler 1 60 M. longipes GGTAGAACGCAACCGGCACGACAGGATCCACT-AGGATGTTTTTCAAACGCCCACCGACT M. altissima GGGAGAACGCAACCG-CACGACATGATC-ACT-AGGTTGTTTTTCAAACGCCCACCGATT M. alstissima var . GGGAGGACACTTCCCGCGTGACG-GGATCACT-AGGTCGTTTCT-RAACGCCCACCGATT M. applanata GGGAGAACGCAACC-GCACGACATGGGTCACTTAGGTTGTTTTTCAAACGCCACCCGACT Rhus succedanea GGGAGAACGCCGCCCGCACGACAGGATCCACT-AGGTTGTGTTTCAAACGGCCACCGATT Rhus taitensis GGTAGAACACGAACCGCACGACCAGGATCACT-AGGTTCTGTTTCAAACGGCCACCGATT Rhus sp. GGGAGAACGCAACCGGCGCGACACAATCCACT-AGGTCGTCTTTCGAACGCCCACCGATC ** ** ** * * * *** *** *** * * * **** * **** 61 120 M. longipes GTTCGCGGTTTAAGCGTCACCGAGAACTCAGATTTGGGCCAACCGGCACGGGCGAGAGCA M. altissima GT-CGCGGGA-AAGCGTCACCGAGAACTCACATTTGGGCCAACCCGCACGGGCGAGCGCA M. altissima var. GT-CACGGR--AAGCGTCACCGAGAGCTCGGGTTTCGGCCAACC-GCGCGTGCGAGCGCG M. applanata GT-CGCGGGGAAAGCGTCACCGAGAACTCATATTTGGGCCAACCCGCACGGGCGAGCGCA Rhus succedanea GTTCGCGGATTAAGCGTCACCGAGAACTCTTATTTGGGCCAACCCGCGGGCGCAAGCACA Rhus taitensis
Image of page 9
Image of page 10

You've reached the end of your free preview.

Want to read all 35 pages?

  • Left Quote Icon

    Student Picture

  • Left Quote Icon

    Student Picture

  • Left Quote Icon

    Student Picture