practice Final Exam

practice Final Exam - 1 Sample Exam/Final Questions from...

Info iconThis preview shows pages 1–5. Sign up to view the full content.

View Full Document Right Arrow Icon
1 Sample Exam/Final Questions from Past Years Question 1) a) Below is shown the DNA that encodes a lysine codon (AAG) in mRNA. 5' AAG 3' 3' TTC 5' Starting with this sequence, show an example of the following types of mutations. Show changes in both strands of DNA. - nonsense mutation - is it a transition or transversion? - missense mutation - is it a transition or transversion? b) Briefly describe how frameshift mutations arise. c) What is a null mutation? Can a null mutation be dominant? Explain briefly .
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
2 Question 2) In monkeys, the allele for pointy ears is recessive to the allele for round ears, short tail is recessive to long tail, and curly fur is recessive to straight fur. Females heterozygous for mutations in all 3 genes were testcrossed, and produced the following 8 classes of baby monkeys (both females and males of each class were obtained): curly fur, pointy ears, short tail 1 curly fur, pointy ears 20 curly fur, short tail 40 curly fur 332 pointy ears, short tail 350 pointy ears 38 short tail 18 wild type 1 Using the symbols c = curly fur; p = pointy ears; s = short tail; + = wild-type allele at each locus: a) Draw a map showing the positions of the three genes and the distances between them. b) Draw the genotype of the heterozygous female parents. Show the proper gene order and proper cis-trans configuration of alleles.
Background image of page 2
3 Question 3) A researcher treated haploid yeast cells with a mutagen and obtained 4 haploid arginine-requiring mutants (a-d), all of which require that arg be added to the medium in order for them to grow. (Without arg, none of them can grow.) The arg-requiring mutants were mated with each other in all pairwise combinations (a x a, a x b, a x c, a x d, etc.), the resulting diploid cells were induced to undergo meiosis, and the resulting haploid spores were plated on medium lacking arg. The chart below is for the % of haploid cells that were able to grow on medium lacking arg. Fill in the chart with values that would tell the researcher that: a and c are alleles of one gene, called arg1 b is in a different gene, called arg 2, on a different chromosome d is in a 3rd gene, called arg3, which maps 16 m.u. away from arg 2 a b c d a 0 b 0 c 0 d 0 Question 4) A segment of double-stranded DNA with a small ORF (open reading frame) is shown below. The start of the ORF is shown with an arrow. a) Indicate on the figure: - the 5' and 3' ends of the DNA strands - which strand of DNA serves as the template for transcription - whether the promoter would be to the left or right of the arrow b) What is the sequence of the coding portion of the mRNA? c) Translate the ORF into amino acid sequence. (A codon chart is on p. 3) - label the amino and carboxy termini of the peptide AGTGATACGGAATCAAGAGCGTTTAGTATCTCGGGCCAATAGTCAACTTTCAAGCA TCACTATGCCTTAGTTCTCGCAAATCATAGAGCCCGGTTATCAGTTGAAAGTTCGT
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
4 Question 5) For all parts of this problem, the A and B genes are 40 m.u. apart on one arm of chromosome 2.
Background image of page 4
Image of page 5
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 06/05/2009 for the course BIO 105 taught by Professor Sullivan during the Spring '08 term at UCSC.

Page1 / 12

practice Final Exam - 1 Sample Exam/Final Questions from...

This preview shows document pages 1 - 5. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online