TranslationFinal

TranslationFinal - BIS2ALECTURE22 Greg Simonds...

Info iconThis preview shows pages 1–11. Sign up to view the full content.

View Full Document Right Arrow Icon
BIS2A LECTURE 22 Greg Simonds
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Topics to Cover Finish transcription Overview of translation The translation machinery The mechanics of translation
Background image of page 2
Stages of transcription A. Initiation of Transcription : RNA polymerase recognizes promoters in the DNA and denatures the DNA around position +1. Promoter --a cis-element in DNA Sequence of E. coli promoters The orientation of the promoter indicates to RNA polymerase which strand will be the template. dsDNA sequence to which RNA polymerase binds - aircraft carrier analogy 5’   . . . TTGACA . . . . . . . . . . . . . . . .TATATT . . .  3’ 3’   . . . AACTGT . . . . . . . . . . . . . . . .ATATAA . .  . 5’ (17-18 bp) -10 -35
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
3' 5' 3' 5' 3' 5' 3' 5' RNA polymerase binds -35 -10 starts synthesis here  (+1) Promoter Gene +1 = first ntd in RNA melts DNA RNA copy of gene
Background image of page 4
Which strand is the template strand? 3 ' 5 ' If the top (gray) strand is chosen . . . +1 -35 -10 A 5’ 3’ U 5’ 3’ as template gene which way? wrong template
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
3' 5' If the bottom (black) strand is chosen . . . +1 -35 -10 A 5’ 3’ T 5’ 3’ as template gene which way? correct template chosen
Background image of page 6
B. Elongation of Transcription : RNA polymerase moves through the gene, adding nucleotides to the 3’ end of the nascent RNA chain. DNA strands renature after RNA polymerase passes. The 5’ end of the RNA is free, the 3’ end is base paired with the DNA. leaves the promoter behind only ~10 bp melted at a time
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
3' 5' 3' 5' -35  -10      +1 gene 5’ 5’ next nucleotide new region melted 5’ 3’ DNA rewinds kicks out RNA
Background image of page 8
C. Termination of Transcription : recognizing when to stop polymerizing. Transcription terminator : a signal in the nascent RNA chain that causes RNA polymerase to release the template and the nascent RNA chain. GGGTCGGGCGGATTA CCCAGCCCGCCTAAT C T C GCCCGAAAAAAAA C T T GTTTT G A A CAAAA G A G CGGGCTTTTTTTT CGGGCUUUUUUUU C C C A G C C C G C A G -OH gene 5’ 3’ complementary sequences
Background image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
GGGTCGGGCGGATTACTCGCCCG CCCAGCCCGCCTAATGACCGGGC A G A A AAAAA C T T GTTTT G A A CAAAA A G TTTTT UUUUU C C C U U U C G G G C G A G C C C G C A G A U C -OH U A A-U base pairs are  the weakest terminator  stem-loop Ouch!   Something’s  poking me!
Background image of page 10
Image of page 11
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 06/07/2009 for the course BIS BIS2A taught by Professor Lucacomai during the Spring '09 term at UC Davis.

Page1 / 54

TranslationFinal - BIS2ALECTURE22 Greg Simonds...

This preview shows document pages 1 - 11. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online