{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

TranslationFinal - BIS2ALECTURE22 Greg Simonds...

Info icon This preview shows pages 1–11. Sign up to view the full content.

View Full Document Right Arrow Icon
BIS2A LECTURE 22 Greg Simonds
Image of page 1

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Topics to Cover Finish transcription Overview of translation The translation machinery The mechanics of translation
Image of page 2
Stages of transcription A. Initiation of Transcription : RNA polymerase recognizes promoters in the DNA and denatures the DNA around position +1. Promoter --a cis-element in DNA Sequence of E. coli promoters The orientation of the promoter indicates to RNA polymerase which strand will be the template. dsDNA sequence to which RNA polymerase binds - aircraft carrier analogy 5’   . . . TTGACA . . . . . . . . . . . . . . . .TATATT . . .  3’ 3’   . . . AACTGT . . . . . . . . . . . . . . . .ATATAA . .  . 5’ (17-18 bp) -10 -35
Image of page 3

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
3' 5' 3' 5' 3' 5' 3' 5' RNA polymerase binds -35 -10 starts synthesis here  (+1) Promoter Gene +1 = first ntd in RNA melts DNA RNA copy of gene
Image of page 4
Which strand is the template strand? 3 ' 5 ' If the top (gray) strand is chosen . . . +1 -35 -10 A 5’ 3’ U 5’ 3’ as template gene which way? wrong template
Image of page 5

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
3' 5' If the bottom (black) strand is chosen . . . +1 -35 -10 A 5’ 3’ T 5’ 3’ as template gene which way? correct template chosen
Image of page 6
B. Elongation of Transcription : RNA polymerase moves through the gene, adding nucleotides to the 3’ end of the nascent RNA chain. DNA strands renature after RNA polymerase passes. The 5’ end of the RNA is free, the 3’ end is base paired with the DNA. leaves the promoter behind only ~10 bp melted at a time
Image of page 7

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
3' 5' 3' 5' -35  -10      +1 gene 5’ 5’ next nucleotide new region melted 5’ 3’ DNA rewinds kicks out RNA
Image of page 8
C. Termination of Transcription : recognizing when to stop polymerizing. Transcription terminator : a signal in the nascent RNA chain that causes RNA polymerase to release the template and the nascent RNA chain. GGGTCGGGCGGATTA CCCAGCCCGCCTAAT C T C GCCCGAAAAAAAA C T T GTTTT G A A CAAAA G A G CGGGCTTTTTTTT CGGGCUUUUUUUU C C C A G C C C G C C U A A U G A G -OH gene 5’ 3’ complementary sequences
Image of page 9

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
GGGTCGGGCGGATTACTCGCCCG CCCAGCCCGCCTAATGACCGGGC A G A A AAAAA C T T GTTTT G A A CAAAA A G TTTTT UUUUU C C C U U U C G G G C G A G C C C G C A G A U C -OH U A A-U base pairs are  the weakest terminator  stem-loop Ouch!   Something’s  poking me!
Image of page 10
Image of page 11
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}