study questions 16

study questions 16 - 6 The structure and position of...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
Study questions 16 1. Write the base-paired complementary strand underneath each of the following sequences, which are all listed 5' to 3': aaaaccctacgttc ttttgattacattt cccctactctacat ggggatcatcatgg 2. Write the complementary strand, 5' to 3', for the following sequences, which are all listed 5' to 3': agctccctacgttc tcgagattacattt cccgtactctacat catcatcatcatgg gatgatgatgattt Consider the following sequence shown 5' to 3'. In a double stranded form this DNA undergoes replication. The origin of replication is centered at the boundary between aaaaa and ttttt. Illus- trate the following by drawing each structure with its sequence: ggggatgatgatgagctccctacgttcaaaaatttttgggggcgtcgtctctctcagattacta 3. The opening replication bubble 4. The position(s) of DNA helicase 5. The structure and position of the leading strand(s) primers
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: 6. The structure and position of possible first lagging strand primer(s) 7. The structure and position of leading strand(s) 8. The structure and position of the Okazaki fragment(s) 9. On each of these structures indicate the position of DNA Polymerase 10. On each of these molecules mark the 3' end 11. Illustrate what a misincorporated nucleotide (an error leading to a mutation) might look like in a leading strand 12. The following molecule (shown 5' to 3') uaggg would work as a ______ on the following DNA sequence (choose from those listed under ques-tion 2) 13. Using the molecule in question 11, employ it in the pertinent DNA replication process show-ing the resulting sequence...
View Full Document

{[ snackBarMessage ]}

Ask a homework question - tutors are online