Topic4.pdf - Topic 4 Extensions to Mendelian Inheritance 1...

  • No School
  • AA 1
  • 43

This preview shows page 1 - 13 out of 43 pages.

Topic 4: Extensions to Mendelian Inheritance 1. Explain why although many genes do not conform to the simple patterns Mendel observed, Mendel’s principles apply to all genetic inheritance. 2. Describe types of single-gene traits that do not conform to the 3:1 phenotypic ratio expected when the trait is caused by a single gene with simple dominance. 3. Describe ways in which genes may interact to affect a trait and ways in which a single gene can affect many traits. 1
Image of page 1

Subscribe to view the full document.

Topic 4: Big Question How can we explain traits that do not show Mendelian Inheritance?
Image of page 2
Are Mendel’s findings the exception or the rule? 7 pea plant traits with simple complete dominance Mendel did reveal key aspects of the inheritance of genotypes, but phenotypes may become “messier” 3
Image of page 3

Subscribe to view the full document.

Complicated Pedigrees Bipolar disorder- chromosomes 3, 18 and 22 DGKH, DGR3, PBRM1 4
Image of page 4
Homologous chromosomes R protein r protein …AGCTTATGGCGATTACC G TATGCTGATCTTTACGTCAT… …AGCTTATGGCGATTACC A TATGCTGATCTTTACGTCAT… R allele r allele Alleles in One Gene A G 5
Image of page 5

Subscribe to view the full document.

Is a new mutation dominant or recessive? Assume – the mutation makes a non- functional product IF the organism needs only one functional copy Homozygous wildtype and heterozygote make same phenotype Mutation is recessive IF the organism needs two functional copies Homozygous mutant and heterozygote make same phenotype Mutation is dominant Haploinsufficiency – one copy is not enough Dominance is complete if only two phenotypic states New notation! A - /A + A + /A + A - /A -
Image of page 6
Fibroblast growth factor receptor gene 3 (FGFR3) – inhibits bone growth early in development Failure of the mutant receptor to turn off in development inhibits bone growth A - /A + FGFR3 signaling Complete Dominance 7 Achondroplasia A + /A +
Image of page 7

Subscribe to view the full document.

Sometimes, heterozygotes show intermediate phenotypes Incomplete Dominance phenotypic ratio 1:2:1 Remember, underlying alleles are still discrete “Intermediate”: Value, ie, color Timing, ie, heart disease when caused by LDL mutation 8
Image of page 8