Topic8.pdf - Topic 8 Transcription and Translation 1 2 3 4...

  • No School
  • AA 1
  • 71

This preview shows page 1 - 14 out of 71 pages.

Topic 8: Transcription and Translation 1. Outline how genes code for traits and understand the role transcription plays in specifying the unique characteristics of tissues and cell types. 2. Describe the mechanism of transcription, including the steps and molecules involved and compare transcription in prokaryotes and eukaryotes. 3. Characterize the modifications made to RNA after transcription and how these modifications affect RNA activity. Investigate the role of un-translated RNAs. 4. Describe how nucleic acids are translated into polypeptide sequences, including the use of the degenerate code and the molecular mechanism of translation in prokaryotes and eukaryotes. 5. Reflect on translation’s role in how genes result in traits (the Central Dogma) and identify exceptions to this process. 6. Survey how biologists study gene expression using mRNA and protein. 1
Image of page 1

Subscribe to view the full document.

Big Question: How do genes code for traits?
Image of page 2
The Central Dogma of Molecular Biology Information flows in one direction: DNA -> protein Transcription (DNA-> RNA) Translation (RNA -> protein) 3
Image of page 3

Subscribe to view the full document.

Composition of DNA vs RNA Chemical: Ribose sugar has an –OH (blue) Thymine base replaced by uracil in RNA (red circle) Physical: Usually single stranded RNA may form other secondary structures (i.e, hairpins) RNA is an unstable intermediary 4
Image of page 4
Transcription- making single stranded RNA from double stranded DNA What is the molecular mechanism of transcription? Stages of transcription: initiation, elongation, termination How is eukaryotic transcription different from prokaryotic? What happens to RNA after transcription? 5
Image of page 5

Subscribe to view the full document.

Transcription How do you go from a two strand molecule to a one strand molecule? Which strand is used as the template? 6
Image of page 6
Transcription 7 aka non-coding aka antisense aka coding aka sense
Image of page 7

Subscribe to view the full document.

CCAGTTGTTTCCGTCTTGTCGGTCTGTCAGGGTTGGAAAGTCCAAGCCATAGGACCCAGTTT GGTCAACAAAGGCAGAACAGCCAGACAGTCCCAACCTTTCAGGTTCGGTATCCTGGGTCAAA GGUCUCAGGGUUGGAAAGUCCAAGCCATAGGACCAGUU The Transcription Unit 8 +1 position -1 position The identity of the sense and nonsense strands vary depending on the gene!
Image of page 8