assignment A bio331 (1).docx - Q1 Incubate a plasmid sample with restriction endonucleases to produce DNA fragments of different sizes by digestion The

assignment A bio331 (1).docx - Q1 Incubate a plasmid sample...

This preview shows page 1 - 2 out of 3 pages.

Q1: Incubate a plasmid sample with restriction endonucleases to produce DNA fragments of different sizes by digestion. The sample, containing fragments, and size markers are transferred to wells in agarose gel and an electric current is generated for electrophoresis. DNA fragments move to different spots towards a positive electrode in the gel, the bands are stained with ethidium bromide, for size visualization. Different sized fragments will be produced for each plasmid, larger ones moving less further. Q2: Use BgIII, HindIII and EcoRI. HindIII and BgIII also works or EcoRI and BgIII. These make different sized fragments for each plasmid. Q3: Alanine-52, Valine-53, Serine-54, Leucine-55, Tryptophan-56, Cysteine-57 Q4: 5’- CGCGGTAGGCTTGTGGTGCTC -3’ Alanine-52, Valine-53, Glycine-54, Leucine-55, Tryptophan-56, Cysteine-57 Q5: This is the membrane threshold (-40mV) and so enough stimulus has been applied to allow voltage-gated sodium channel to open and allow flow of sodium ions into the cell, causing depolarization.
Image of page 1

Subscribe to view the full document.

Image of page 2
  • Winter '18

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern

Ask Expert Tutors You can ask 0 bonus questions You can ask 0 questions (0 expire soon) You can ask 0 questions (will expire )
Answers in as fast as 15 minutes