exam2_w07_key

exam2_w07_key - Name: _ Bis098-400 (Bis2A Pilot) SID: _...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
1 Name: _____________________________ SID: _____________________________ Bis098-400 (Bis2A Pilot) Second Midterm Exam February 21, 2007 Write name, SID, and answers on Scantron 1. It has been suggested that biosynthetic pathways evolved “backwards” in the sense that the last enzyme in the synthetic pathway was the first to appear and preceding steps in the sequence of reactions evolved later in time. This idea seems at first glance to be most consistent with which of the following ideas for origin of life – a) Synthetic pathways evolved first, before any system of inheritance was in place. b) Organic molecules accumulated on earth (from meteors and abiotic synthesis) and formed a “primordial soup” in which life originated. c) Life originates regularly by “spontaneous generation” in dirty rags. d) The first living things were autotrophs that lived on mineral surfaces in hydrothermal vents. e) Cells arose after biosynthetic pathways were in place. 2. Do you expect that all autotrophs must be able to respire? a) No, methanogens don’t (or do they?). b) Yes, that’s basically how plants make ATP. c) Yes, but if first life was autotrophic, it had to get along without it. d) “a” and “b” are right. e) “b and “c” are right. 3. The redundancy of the information content in DNA helps explain a) How genetic information is encoded. b) How genetic information is replicated c) How genetic information is repaired and recombined d) Only “b” and “c” are right. e) All of the above 4. Why does life spend two high-energy PO 4 bonds (rather than one) to add a deoxynucleotide in DNA synthesis? a) The larger amount of released energy speeds up the reaction rate b) The heat generated helps melt DNA into two strands c) This minimizes the possibility that the reaction goes backwards and destroys previously made product. d) This demonstrates the esteem in which DNA is held by metabolic enzymes e) This compensates for the extremely low concentration DNA (only one molecule per cell)
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
2 5. Below is the sequence of a region of a DNA molecule (note indicated strand polarity). There is a gap in one strand because a repair system recognized a damaged base and excised the region that included it. In the process of completing this repair, which three bases will be added first --- listed in the order of their addition. 5’ ATGCCCGTATCGGTTAACCTTC 3’ 3’ TACG------------TGGTTG 5’ a) C, C, G b) G, G, C c) T, A, A d) A, T, T e) T, A, C 6. In the act of recombination, two very similar double-stranded DNA molecules exchange parts by a event occurring within shared identical base-pair sequences --- the left half end of one molecule is joined to the right half of the other (see diagram). This joining is essentially perfect. The actual process by which recombination occurs is complex with multiple steps.
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 07/03/2009 for the course BIS 64982 taught by Professor Comai during the Winter '09 term at UC Davis.

Page1 / 9

exam2_w07_key - Name: _ Bis098-400 (Bis2A Pilot) SID: _...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online