key_dnaandcode_problemset2

key_dnaandcode_problemset2 - Problem Set on Inheritance and...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Problem Set on Inheritance and Selection 1. Below is a DNA sequence from the MIDDLE of a gene. 5’ G T C A A A A A T G G C T A G C T A G A 3’ 3’C A G T T T T T A C C G A T C G A T C T 5’ 1a How many possible ways are there to try and translate this sequence? Six There are 6 possible ways to read this sequence Reading the top strand 3’ to 5’ (to make an mRNA 5’ to 3’) we get: 5’ UCUAGCUAGCCAUUUUUGAC 3’ which could have the following 3 reading frames: UCU•AGC•UAG•CCA•UUU•UUG•AC or U•CUA•GCU•AGC•CAU•UUU•UGA•C or UC•UAG•CUA•GCC•AUU•UUU•GAC. Reading the bottom strand 3’ to 5’ (to make an mRNA 5’ to 3’) we get: 5’ GUCAAAAAUGGCUAGCUAGA 3’ which could also have 3 reading frames: GUC•AAA•AAU•GGC•UAG•CUA•GA or G•UCA•AAA•AUG•GCU•AGC•UAG•A or GU•CAA•AAA•UGG•CUA•GCU•AGA 1b What amino acid sequence is encoded here? (Which of the ways listed above is actually used?) (Careful – this isn’t so easy – use the code table). Write the encoded amino acid sequence from NH 2 end to COOH end. template (nonsense) strand in the DNA: 3’CA•GTT•TTT•ACC•GAT•CGA•TCT 5’ which encodes the mRNA 5’ GU•CAA•AAA•UGG•CUA•GCU•AGA which encodes the Amino acids: Glu lys trp leu ala arg – or Q – K – W – L – A – R (all other frames include termination codons!) 1c How many ways are there to generate a UAG nonsense mutation in this sequence by a single base substitution (for this you need to have your answer to 1b). I find one (in the template strand, ACC to ATC, resulting in mRNA of UGG to UAG) (assuming the mutation has to happen by one change only, not multiple changes) 1d What would be the last amino acid in the protein made by mutant above? lys - AAA 1e What region of the above sequence is likely to be prone to frameshift mutations (+1 and -1)? The run of A residues is prone to strand slipping during DNA replication – AAAAA TTTTT 1f If a +1 mutation occurred in this region, what would be the last amino acid in the mutant protein? GU•CAA•AAA•
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 07/03/2009 for the course BIS 64982 taught by Professor Comai during the Spring '09 term at UC Davis.

Page1 / 5

key_dnaandcode_problemset2 - Problem Set on Inheritance and...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online