{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

Challenge%20problem%20frameshift%20sequence

Challenge%20problem%20frameshift%20sequence - cases to see...

Info icon This preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
Challenge problem frameshift sequence The sequence below is the start of a gene coding a protein (starts with Met). There are 3 sites indicated where frameshift mutants occur. Any one mutant inactivates the product resulting in a loss of function. The sum of all 3 mutants, however, restores function. Thus, all 3 mutants are either (-) or (+). Work out the possible polypeptide chains for both
Image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: cases to see if this tells us whether the mutants are (-) or (+). Assume if each mutation is a deletion that it is one of the identical nucleotides at the labeled site (ie, delete an A at site 1). If each is an addition assume it is the same nucleotide as the other pair at each labeled site (ie, make the mutant AAA at site1). UUUAGGGAACCUUGGAACCUUGGAACCUUGGAACC…. . 1 2 3...
View Full Document

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern