Challenge%20problem%20frameshift%20sequence

Challenge problem% - cases to see if this tells us whether the mutants are or Assume if each mutation is a deletion that it is one of the identical

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
Challenge problem frameshift sequence The sequence below is the start of a gene coding a protein (starts with Met). There are 3 sites indicated where frameshift mutants occur. Any one mutant inactivates the product resulting in a loss of function. The sum of all 3 mutants, however, restores function. Thus, all 3 mutants are either (-) or (+). Work out the possible polypeptide chains for both
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: cases to see if this tells us whether the mutants are (-) or (+). Assume if each mutation is a deletion that it is one of the identical nucleotides at the labeled site (ie, delete an A at site 1). If each is an addition assume it is the same nucleotide as the other pair at each labeled site (ie, make the mutant AAA at site1). UUUAGGGAACCUUGGAACCUUGGAACCUUGGAACC…. . 1 2 3...
View Full Document

This note was uploaded on 07/08/2009 for the course LIFESCI ls 4 taught by Professor Merriam during the Winter '08 term at UCLA.

Ask a homework question - tutors are online