PCR 기초강좌 17 - PCR을 ì&acu

PCR 기초강좌 17 - PCR을 ì&acu

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: H. Nakayama 17 No.18 Life Science & Biotechnology 17 A: 3'-N2N- CCGTTACAGCTGGAGGGATGTTGGGCTTAAGGATGp-5' B: C: 5'- GGCAATGTCGACCTCCCTACAAC-3' 5'- CTCCCTACAACCCGAATTCCTAC-3' * Zhi Chen : Simple modifications to increase specificity of the 5 -RACE procedure, Trends in Genetics 12 : 87-88, 1996 18 No.18 Life Science & Biotechnology 18 No.18 Life Science & Biotechnology 19 '- Mlu I Spe I 5' - CUA CUA CUA CUA GGC CAC GCG TCG ACT AGT ACG GGI IGG GII GGG IIG 3' UDG cloning site adaptor Sal I anchor Mlu I Spe I 5' - CUA CUA CUA CUA GGC CAC GCG TCG ACT AGT AC 3' UDG cloning site Sal I Mlu I Spe I GGC CAC GCG TCG ACT AGT AC 3' Sal I 20 No.18 Life Science & Biotechnology No.18 Life Science & Biotechnology 21 BIOMEDICALS Tel. 02-577-2002 Fax. 02-577-3691 E-mail [email protected] URL www.takara.co.kr 22 No.18 Life Science & Biotechnology ...
View Full Document

This note was uploaded on 08/01/2009 for the course 221 22412 taught by Professor Maz during the Spring '09 term at A.T. Still University.

Ask a homework question - tutors are online