Transgene inactivation in Agrobacterium-mediated chrysanthemum(Dendranthema gransdiflrum(Ramar.) Kit

Transgene inactivation in Agrobacterium-mediated chrysanthemum(Dendranthema gransdiflrum(Ramar.) Kit

Info iconThis preview shows pages 1–5. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: 241 Short Colnmunication ptant Biotechnotogy, 17 (3), 241- 245 (2000) Transgene inactivation in Agrobacterium - mediated chrysanthemum (Dendranthema grandiiflorum (Ramat.) Kitamura) transformants Yasumasa TAKATSU1) * , Mikio HAYASHll) and Fumio SAKUMA2) 1) Plant Biotechnology Institute, IbarakiAgricultural Center, Iwama, Nishi- ibaraki, 319- 0292. Japan - )Horticultural Institute. IbarakiAgricultural Center, Iwama. Nishi- ibaraki, 319- 0292, Japan *Corresponding author E-mail address: yasut@post,agri,pref.ibaraki,jp Received 11 January 2000; accepted 12 May 2000 Abstract To compare transformation frequency and to investigate the developmental alterations in transgene two cut- flower chrysanthemums 'Yamabiko' (spray-type) and 'New Summer Yellow' (standard - type) were transformed with three disarmed Agrobacterium tumefaciens strains C58C1, expression, MP90 and LBA4404, having the pB1121 plasmid. No marked difference was observed in among cultivar/bacterial strain combinations. - glucuronidase (GUS) activity levels in transformants were fairly low and varied different transgenic lines, ranging among the from 30 to 250 pmol min I (mg protein) I GUS expression not observed in the transgenic lines all strains transformation efficiency was . transformed with strain LBA4404. The alterations of GUS activity levels were examined for a long term, and it was observed that GUS activities reduced to zero level in most of transgenic lines 12 months after the inoculation of bacteria. Chrysanthemum (Dendranthema grandlflorum (Ramat.) Kitamura) is a major cut flower in the world, and its various characteristics have been improved through conventional breeding programs. Molecular breeding is an alternative approach to introduce specific characteristics, and it has an especial advantage in 'one point' crop improvement. During the last decade, transgenic plants of chrysanthemum have been produced by using an Agrobacterium -mediated transformation technique (Ledger et al. , 1991; Wordragen et al. , 1991; Renou et al., 1993; Urban et al., 1994; De Jong et al., 1994; Fukai et al., 1995; Sherman et al., 1998a), and transgenic chrysanthemums with practical charhave also been produced (Sherman et al. , 1998b; Takatsu et al., 1999). However the transformation efficiency remains fairly low, and the chrysanthemum - cultivar/ Agrobacterium - strain specificity (Bush and Pueppke, 1991; Urban et al., 1994) remains to be investigated, especially in Japanese acteristics cultivars. Recently, the silencing of a transgene has of several species been observed (Finnegan and McElroy, 1994; Meyer, 1995; Vaucheret et al., 1998), and it was also reported that the in transformants expression levels of a transgene varied among different transformants in chrysanthemum (Sherman et al., 1998b). In this study, we examined the cultivar/bacterial strain specificity affecting the transformation efficiency and the developmental GUS activity in transformants to imtransformation protocol for chrysanas a practical breeding technique. alteration of prove the themum We selected two cut-flower chrysanthemums 'Yamabiko' (spray-type) and 'New Summer Yellow' (standard-type) because of their high regeneration ability (Takatsu et al. 1998). Stem segments , 3 mm long were excised from the shoots and cut into half sections vertically, which were used as MS explants in the transformation experiments. supplel-1 gelrite (Wako, mented with 30 l-1 sucrose, Japan), 2.0 mg l- L indoleacetic acid and 0.2 mg l 1 benzyladenine was used as a shoot induction medium (MIB medium). All cultures were incubated in medium (Murashige and Skoog, 1962) g 3g a growth chamber maintained at 25 'C and illuminated at 50 /Imol m 2 s 1 for 16 h per day. Three disarmed A. tumefaciens strains C58C1 (C58CIRifR having the octopine-type helper plasmid pGV2260: Deblaere et al., 1985), MP90 (C58CIRifR having the nopaline-type helper plasmid pMP90: Koncz and Schell, 1986) and LBA4404 (Clontech, USA) were used. All three harbored the binary plasmid pB1121, which had the neomycin phosphotransferase 11 (NPT ) and GUS genes in the T-DNA region. Bacteria were cultured overnight at 28 C in Luria Broth medium (10gl-] tryptone, 5g l-1 yeast extract, lOg l-1 NaCl, pH7.0) containing 50 mg l-L kanastrains 242 mycin sulfate. Agrobacterium suspension was luted to 1:20 in sterilized distilled water (about 107 cells/ ml) and was supplemented with 100 and 2.5 units AmpliTaq (Perkin Elmer) in 10 di- 5 mM > amplification conditions for the GUS fragment min at preheating; then 94 'C were: 95 'C for ,M 9 5 (3 ' ' - Dimethoxy - 4' - hydroxyacetosyringone , acetophenone) just before inoculating explants. Stem segments were dipped in the diluted suspension and placed on MIB medium. After two days of co - cultivation, these explants were transferred to fresh MIB medium containing 10 mg l-1 kanamycin sulfate and 250 mg l-1 cefotaxime (Kyowa. Japan) select transformants. Forty-five days after inocuto lation, regenerated green healthy shoots were separated from the explants and were transferred to hormone-free MS medium containing 10mg l-l kanamycin sulfate. Rooted shoots were continuously maintained on the same medium as putative denaturing for I min, 62 'C annealing for 2 min and 72 'C extension for I min for 40 cycles; and another fragment 72 'C extension for min. Amplified gel, transferred separated on a 1.5 agarose was 5 DNA LIFE SCIENCE). DNAS phytopure (Amersham extracted from a GUS gene. GUSI (5'-CAGC- Fig. YM and 3 YL Iines N of transgenic YC Iines, 6 were transformed by respectively. from pB1121, N: non- transC58CIRifR (pGV2260), MP90: formant, C58C1: C58CIRif (pMP90). Cultivar/Agrobacterium strain combinations affecting the efficiencies in the transfonnation of chrysanthemum. Chrysanthemum Agrobactertum strainl No. of No. of No. of inoculated putative transgenic trans- lines2 explants No, of GUS- Efficiency positive lines 2* 6m 12m fonnants (% ) (B/A) (C/A) (C/B) (D/C) (E/D) 1 1 O 0.81 o 27 o 82 100_O 33.3 0.89 0,0 33.3 50.0 0.0 100 1.64 (B) (A) (C) (D) (E) MP90 LBA4404 1 3 O 1 1 O 21 8 3 6 3 59 l2 4 2 2 1.12 o.37 33.3 50 291 272 274 13 lO 5 5 O 2 5 O 1 3 O 3.09 1.72 1.84 1.84 7 9 5 2 O.73 0.0 837 C58C1 368 366 337 l 07 1 Yamabiko - P: positive control DNA cultivar Iines C58C1, MP90 and LBA4404, mM l. analysis blot chrysanthemum 'Yamabiko'. Three primers amplify a 684 bp fragment. The PCR KCl, 1.5 mixture (50 Ill) was composed of 50 200 /lM of each of dATP, dGTP, dCTP MgC12 , and dTTP, 0.2 !tM primers, 100 ng template Table '-- r Ll*ne Y 'l.1*n* I PCR - Southern ' mM Ir ( Iin'* GAAGAGGCAGTCAACGGGGAA- 3') and GUS2 (5 - CATTGTTTGCCTCCCTGCTGCGGTT - 3 ) ' % % non- transformant and purified pBll21 were used as negative and positive controls, respectively. The integrated GUS gene was detected by PCR using two oligonucleotide primers (GUSI and GUS2) specific for the % DNA Putative transformants were screened for the presence of GUS gene by the PCR-Southern analysis. Genomic was extracted from leaf using NucleonT DNA onto a nylon membrane (BIODYNETlvlB, Paul), and then hybridized with the labeled GUS gene prove prepared from the plasmid. Labeling of the GUS gene, Southern hybridization and visualization were performed according to the protocols given in the Labeling and Detection Kit (Roche & DIG Boehringer Mannheim). We used totally 1,071 stem segments of 'Yamabiko' as explants, and obtained 59 shoots as putative transformants (Table 1). The GUS gene was detected in 12 Iines of different origin by PCRSouthern blot analysis (Fig. 1), and the transformation efficiencies (N0. of transgenic lines/No, of for explants) were 0.81 %, 1.64 and 0.89 transform ants. tissues DNA Polymerase Tris-HCI (pH8.5). The GoldTlvl 30 16 10 7 4 1 91 120 , New Summer C58C1 Yellow MP90 LBA4404 30 1 C58C1: C58CIRrf (pGV2260), MP90: C58CIRif} (pMP90) 2 - glucurcnidase (GUS) gene was detected by PCR- Southem analysis. 3 Transgenic lines showing GUS ativity 2 months (2 m), 6 months (6 m) and 12 months (12 O 100.0 0.0 O.C O 100.0 55.6 100.0 40.0 100.0 50.0 60.0 O.O 0.0 0.0 5 70.0 57.1 62 m) after inoculation. 243 C58C1, MP90 and LBA4404, respectively. With 837 stem segments of 'New Summer Yellow', 60 min obtained 30 shoots as putative transformants. GUS gene was detected in 16 Iines, and the and transformation efficiencies were 3.09 %, 1.84 for strains C58C1, MP90 and LBA4404, 0.73 respectively. Wordragen et al. (1991) reported that the nopaline-type strain C58 (the parent strain of C58C1 and MP90) showed a higher virulence to chrysanthemum than the octopine- type strain Ach5 (the parent strain of LBA4404). However, in our study, no marked difference was observed in the transformation efficiency among bacterial strains, and between the octopine type (pGV2260) and nopaline type (pMP90) helper plasmids. To investigate the developmental alterations in GUS expression, GUS assays were performed 2 months Gust after regeneration) and 6 months (with 2 times of subculture) after inoculation using transgenic plants growing in vitro, and 12 months after inoculation using acclimatized plants growing in a closed greenhouse. GUS activity was assayed by measuring the conversion of 4-methylumbelliferyl the present study was found to be comparable to those of other studies of transgenic chrysanthemum strains GUS we The % % at 37 C. activity levels 2 months after inoculation in 1994; Urban et al., 1994; Sherman et al., 1998a), but varied greatly among different transgenic lines, ranging from 30 to 250 (Pavingerova et al., pmol min 1 (mg protein) 1, GUS expression was detected % (3/6) and 0.0 % % as shown in Fig, 2. (1/3), 50.0 in 33.3 % (0/3) of transgenic 'Yamabiko', % % (0/2) (5/9), 100.0 (5/5) and 0.0 55.6 and of transgenic 'New Summer Yellow' transformed in by C58C1, MP90 and LBA4404, respec- strains Transgenic lines expressing GUS activity 2 months after inoculation were defined as GUS-positive (2 months) Iines. No marked difference was observed in the efficiency of GUS-positive (2 months) Iines (No. of transgenic lines expressing GUS gene No. of explants) between in 'Yamabiko' and SumC58C1 and MP90 Yellow' (Table 1). While, GUS expression was mer not detected in all lines transformed with LBA4404, although the presence of the GUS gene was confirmed by PCR-Southern analysis in these lines. Previous studies showed that some transformants of chrysanthemum did not express an introduced foreign gene (Renou et al., 1993; De Jong et al., 1994; tively (Table l). / -D-glucuronide (MUG) to 4-methylumbel(MU) by extracts from secondary leaves of transgenic plants as described by Jefferson (1987). GUS assay buffer contained 20 % methyl alcohol was used to eliminate endogenous GUS activity (Kosugi et al., 1990). Protein concentration in the reaction mixtures was determined by the method of Bradford (1976) using a kit supplied by Bio-Rad Laboratories (USA). GUS activity was detected for liferone Urban et al., 1994). Although the failure to obtain transformants expressing GUS gene may be due to the inactivation of transgenes, these transformants that do not express GUS gene are able to eliminate in early step of experiments. I (*g p*otei ) ' pmd *i ・ . __/fl: '--"__' 250 i ---l 200 > * 150 *o cl' ::, (:! ; = :; _ OO I -i 50 O i f --- Ji ; '/ : e,¥ (¥ : ' , tC'9,, .) J C; '= r r JQ f F: ・-,=09) b t' . t, $C'¥ ;' l ('f:) J:' ; ) d oL ' (i¥ , J 2m /5m J12m ' -L :c'¥ Transgenic Fig. 2 GUS activities in different transgenic lines months (12 m) after inoculation Summer Yellow' line are lines NM 6 months (6 m) and 12 and 5 NC Iines are 'New and 3 YM Iines and YC14 (2 m), Iines MP90 and C58C1, transformed with strain MP90 and C58C1, respectively. transformed with strain 'Yamabiko' 2 months of bacteria. Five 244 Stable expression of the transgene is necessary for plant molecular breeding, and thus the developactivity levels were mental alterations in GUS examined After 100.0 6months and 12 months after inoculation. 6 months, GUS % months) % expression % was observed 100.0 transformed with strains % C58C1 and MP90, tively (Table 1). In the other lines, GUS GUS respec- activities were reduced nearly months, in (1/1) or 33.3 (1/3) of GUS-positive (2 (2/5) or Iines of 'Yamabiko', and in 40.0 (5/5) of those of 'New Summer Yellow' to zero level (Fig. 2). After expression was observed in 100.0 % 12 % (1/1) of GUS-positive (6 months) (1/1) or 100.0 (1/2) or 60.0 lines of 'Yamabiko', and in 50.0 % (3/5) of those of 'New Summer Yellow' % trans- formed with strains C58C1 and MP90, respectively (Table l). GUS activities were reduced to very low levels in most lines except for YC14 (Fig. 2). Transgene inactivation (silencing) has been observed in several plant species and some models have been proposed for transcriptional and posttranscriptional silencing (Vaucheret et al., 1998). Transgene can undergo transcriptional silencing when single or multiple copies are integrated into a locus located in next to silent hypermethylated genomic sequences (position effect), and it has also been suggested between the of the transgene and that of the surrounding genomic sequences leads to the specific methylation and inactivation of foreign sequence. On the other hand, post-transcriptional silencing is defined as that does not accumulate even that strong discrepancy DNA composition RNA though transcription occurs, and it has been suggested that it is mainly due to the overproduction and specific degradation of transgene RNA (RNA threshold model). Aida and Shibata (1998) observed developmental transgene silencing in Torenia fournieri and reported that initial levels of GUS activity correlated with the timing of silencing, and it occurred more rapidly in the homozygous plants compared with the hemizygous plants. They also suggested that transgene silencing was explained by RNA threshold model the study. GUS in torenia. In the present activity levels in transgenic chrysan- themums were 10-fold less than those of tobacco (Daub et al., 1994) and 100-fold less than those of Kalanchoe blossfeldiana (Aida and Shibata, 1996) both transformed with pB1121. The initial levels (2 months after inoculation) of GUS activity were fairly low, and 50.0 % ('Yamabiko') and 70.0 % ('New Summer Yellow') of GUS-positive (2 months) plants still showed GUS activity 6 months after inoculation, and it was showed that silencing occurred slowly in chrysanthemum. According to the RNA threshold model, these observations imply needs a long term to produce the transgene above a putative threshold level in chrysanRNA themum. However, as developmental regulation of transgene silencing by methylation (transcriptional silencing) is also reported in tobacco plant (Sonoda and Nishiguchi, in press), there is room for further investigation about developmental transgene inactivation in chrysanthemum. GUS activity reduced to very low level in most of transformants 12 months after inoculation, and only spray-type chrysanthemum YC14 Iine showed stable GUS expression for a long term with a relatively low- activity level. Sherman et al. (1998a) that it reported that the stability of GUS expression varied according to cultivar. The difference in genetic background of cultivar may also affect the transgene inactivation Wordragen chrysanthemum. in In addition, (1992) reported that expression of driven by the cauliflower mosaic gene virus 35S (CaMV35S) promoter started slowly in the et al. GUS chrysanthemum (5 days after infection) compared to tobacco plants (2 days after infection). This observation implies that the CaMV35S promoter behaves chrysanthemum than in tobacco plant. Although the mechanisms influencing transgene expression remains to be investigated, attention should be given to them in the application of transformation techniques in chrysanthemum breeding differently in programs. Acknowledgment We wish to thank Dr. H. Ezura (Plant Biotechnology Institute, Ibaraki Agricultural Center) for useful suggestions and reviewing the manuscript. References Aida, R., Shibata. M., 1996. Transformation of Kalanchoe blossfeldiana mediated by Agrobacterium tumefaciens and transgene silencing. Plant Sci , 121: 175 - 185. Aida, R., Shibata, M., 1998. Developmentally Regulated Transgene Silencing Bradford. M M., 1976. A in Torenia Breed.Sci., 48: 36- 69. rapid and sensitive method for the quantitation of mic.rogram quantities of protein utilizing the principle of protein- dye- binding. Anal. Biochem., 72: 248- 254. Bush, A.L., Pueppke, S_, 1991. Cultivar-strain specificity between Chrysanthemum monfolium and Agrobacterium tumefaciens. Physiol Mol. Plant Pathol., 39: 309 - 323. Daub, M.E., Jenns. A.E., Urban. L_A.. Brintle, S.C., 1994. Transformation frequency and foreign gene expression in burley and flue- cured cultivars of tobacco. Tob. Sci., 38: 51 - 54. Doblaere. R Bytebier, B.. De Greve, H Deboeck. F., . , Schell. J Van Montagu. M.. Leemans. J., 1985_ . Efficient octopine Ti plasmid-derived vectors for 245 Agrobacterium - mediated gene transfer to plants. Nucl. Acids. Res., 13: 4777-4788. De Jong. J. Mertens. M M.J., Rademaker, , 1994. Stable expression of the GUS reporter gene in chrysanthemum depends on binary plasmid T-DNA Plant Cell Rep., W 14: 59-64 Finnegan, D McElroy, J.. , 1994. Transgene inactivation: 883- 888. Plants fight back! Bio/Technology, 12: Rademaker, W., 1995. Efficient De genetic transformation of chrysanthemum (DendranKitamura) using stem th.ema grandtflorum (Ramat Sci., 45: 179- 184 segments Breed Jefferson. R.A., 1987 Assaying chimeric genes in plants: the GUS gene fusion system Plant Mol. Bial Rpt., 5: 387405 Koncz, C., Schell. J., 1986. The promoter of Tl - DNA gene Fukai. S., Jong. J., ) 5 controls the tissue-specific expression of chimaeric genes carried b), a novel type of Agrobacterium binary vector Mal. Gen. Genet., 204: 383- 396. Kosugi, S., Ohashi, Y., Nakajima, K., Arai, Y., 1990. An -glucuronidase in transformed improved assay for Methanol almost completely suppresses a putative -glucuronidase activity. Plant Sci., 70: endogenous cells: 133 - 140. Ledger. S_E., Deroles, S C., Given, N K., 1991. Regeneration and Agrobacterium-mediated transformation of chrysanthemum Plant Cell Rep., lO: 195- 199 Meyer. P 1995. Variation of transgene expression in plants. , Euphytica, 85: 359- 366. Murashige. T., Skoog, F., 1962. A revised medium for rapid growth and bioassays with tobacco Physiol.Plant., 15: 473- 497 tissue cultures. Biskova. R.. Benetka. V., 1994. Somatic embryogenesis and Agrobacterium - mediated transformation of chrysanthemum. Plant Sci., 97: 95- Pavingerova, D., Dostal. J., 101. Renou. JP., Brochard. P , Jalouzot. R., 1993. Recovery of transgenic chrysanthemum (Dendranthema grandiflora Tzvelev) after hygromycin resistance selection. Plant Sci., 89: 185- 197. M E., 1998a A regenSherman, J.M., Moyer, J.W., Daub, eration and Agrcbacterium - mediated transformation System for genetically diverse Chrysanthemum cultivars. J_ Amer. Soc. Hort. Sci , 123(2): 189- 194. Sherman, J.M., Moyer, JW., Daub, M.E., 1998b. Tomato Spotted Wilt Virus Resistance in Chrysanthemum Expressing the Viral Nucleocapsid Gene. Plant Disease. 82(4): 407- 414. Nishiguchi, M., in press Delayed activation of post-transcriptional gene silencing and de novo transgene methylation in plants with the coat protein gene of Sonoda, S., sweet potato feathery mottle potyvirus Plant Sci Y , Tomotsune, H., Kasumi, M., Sakuma, F., 1998 Differences in adventitious shoot regeneration capacity Takatsu, among Japanese chrysanthemum (Dendranthema grandlflorum (Ramat.) Kitamura) cultivars and the improved protocol for Agrobacterium - mediated genetic transformation. J. Japan. Soc. Hort. Sci., 67(6): 958- 964. Takatsu, Y., Nishizawa, Y., Hibi, T., Akutsu, K., 1999. TTansgenic chrysanthemum (Dendrantkema grandiflorum (Ramat.) Kitamura) expressing a rice chitinase gene shows enhanced resistance to gray mold (Botrytis cinerea). Sci. Hort., 82: 113- 123. Urban, L.A., Sherman, J.M , Moyer, J.W., Daub, M.E_, 1994. High frequency shoot regeneration and Agrobacterium - mediated transformation of chrysanthemum (Dendranthema grandlflora). Plant Sci., 98: 69 - 79. Vaucheret, H., Beclin, Godon, D., Morel, C JB Elmayan, , , Mourrain, T , P., Feuerbach, F., Palauqui, J.C., 1998 Transgene-induced gene silencing in plants. Plant J 16(6): 651- 659 , Wordragen, M.F., De Jong, J., Huitema, H.B.M , Dons, Vernhettes, S., 1991. Genetic transformation of chrysanusing wild type Agrobacterium strains; strain tbcmum and cultivar specificity. Plant Cell Rep., 9: 505 - 508 H,i.M., Wordragen, M.F., H.J.M., 1992 De Jong, J , M J., Dons, host-bacterium Schornagel, Rapid interactions in Agrobacterium-mediated gene transfer to chrysanthemurn, by using the GUS-intron gene. Plant Sci 81: 207-214. , screening for ...
View Full Document

Page1 / 5

Transgene inactivation in Agrobacterium-mediated chrysanthemum(Dendranthema gransdiflrum(Ramar.) Kit

This preview shows document pages 1 - 5. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online