lecture_4__05 - DNA RNA PROTEIN Gene A hereditary unit...

Info iconThis preview shows pages 1–5. Sign up to view the full content.

View Full Document Right Arrow Icon
1 chromosome = 1 DNA helix (2 strands) each chromosome can contain many genes, which are defined by their DNA sequence Fig. 17.3 DNA RNA PROTEIN Genes account for only a small percentage of the total DNA on a eukaryotic chromosome In general, a gene “encodes” a single polypeptide (protein) = a gene centromere Gene : A hereditary unit consisting of a sequence of DNA that occupies a specific location on a chromosome and determines a particular characteristic in an organism.
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Fig. 17.2 Separation of transcription from translation in eukaryotic cells: in prokaryotic cells, everything occurs in the same central cellular compartment. In eukaryotic cells, transcription occurs in the nucleus, mRNA’s are transported out of the nucleus to the cytoplasm where they are translated into proteins
Background image of page 2
The code present in DNA is first transcribed into an RNA message (mRNA) ATGACGTATAGCAGGGACCGATCACAGCGATACAGT TACTGCATATCGTCCCTGGCTAGTGTCGCTATGTCA AUGACGUAUAGCAGGGACCGAUCACAGCGAUACAGU 5 3 CHROMOSOME mRNA: GGCAGGCACT CCGTCCGTGA ATAGGTCCAGT TATCCAGGTCA template strand non-template strand TRANSCRIPTION: TRANSLATION: The mRNA is then translated into a polymer of amino acids (a polypeptide, protein) AUGACGUAUAGCAGGGACCGAUCACAGCGAUACAGU 5 3 mRNA: Met Thr Tyr Ser Arg Asp Arg Ser Gln Arg Tyr Ser protein:
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
each 3 nucleotides code for 1 amino acid; each triplet of nucleotides is called a codon a string of amino acids is a polypeptide (protein
Background image of page 4
Image of page 5
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 12

lecture_4__05 - DNA RNA PROTEIN Gene A hereditary unit...

This preview shows document pages 1 - 5. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online