2 - Answers - Paull BIO 212 Problem Set #2 (15 pts) Due on...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Paull BIO 212 Problem Set #2 (15 pts) Due on Feb. 3/4 The genetic code/ transcription 1 . (1 pt) If the open reading frame of a gene is 999 base-pairs, how many amino acids does it encode? 2 . (2 pts) A new form of life is discovered. It has a genetic code much like that of other organisms except that there are five different DNA bases instead of four and the base sequences are translated as doublets instead of triplets. How many amino acids could be accommodated by this genetic code? 3 . (4 pts) a. Fill in the bottom strand of this DNA molecule, plus the 5’ and 3’ designations. b. Translate the reading frames for the top strand. Which reading frame constitutes an ORF? c. Which reading frame constitutes an ORF on the bottom strand? ProAlaGlnIleArg Stp AsnSerThrMetAspTyrProAspPro ThrCysSerAspProIleLysLeuAspTyrGlyLeuSer Stp Ser TyrLeuLeuArgSerAspLysThrArgLeuTrpThrIleLeuIleGln 5’- TACCTGCTCAGATCCGATAAAACTCGACTATGGACTATCCTGATCCAG –3’
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

This document was uploaded on 09/06/2009.

Page1 / 2

2 - Answers - Paull BIO 212 Problem Set #2 (15 pts) Due on...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online