2 - uracil/thymidine): a. the template strand b. the...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Paull BIO 212 Problem Set #2 (15 pts) Due on Feb. 3/4 The genetic code/ transcription 1 . (1 pt) If the open reading frame of a gene is 999 base-pairs, how many amino acids does it encode? 2 . (2 pts) A new form of life is discovered. It has a genetic code much like that of other organisms except that there are five different DNA bases instead of four and the base sequences are translated as doublets instead of triplets. How many amino acids could be accommodated by this genetic code? 3 . (5 pts) a. Fill in the bottom strand of this DNA molecule, plus the 5’ and 3’ designations. b. Translate the reading frames for the top strand. Which reading frame constitutes an ORF? c. Which reading frame constitutes an ORF on the bottom strand? 5’- TACCTGCTCAGATCCGATAAAACTCGACTATGGACTATCCTGATCCAG –3’ 4 . (1 pt) An mRNA sequence is identical to which strand of DNA (apart from the
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 2
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: uracil/thymidine): a. the template strand b. the non-template strand 5 . (2.5 pts) Describe five differences between DNA polymerization and RNA polymerization. 6 . (1 pt) When the end of a chromosome is replicated, which strand is left with a gap at the end of the telomere? a. the leading strand b. the lagging strand c. neither strand is left with a gap 7 . (2.5 pts) A single nucleotide deletion and a single nucleotide addition approximately 15 base-pairs apart in the DNA within an open reading frame causes a change in protein sequence from:-Lys-Ser-Pro-Ser-Leu-Asn-Ala-Ala-Lys to-Lys-Val-His-His-Leu-Met-Ala-Ala-Lys What was the sequence of the original mRNA? A. 5’-AAAAGCCCUUCACUCAAUGCUGCUAAG-3’ B. 5’-AAGAGUCCAUCACUUAAUGCUGCUAAG-3’ C. 5’-AAAAGUCCGUCCCUCAACGCUGCAAAA-3’ D. 5’-AAGAGCCCAUCCCUUAACGCAGCUAAG-3’...
View Full Document

This document was uploaded on 09/06/2009.

Page1 / 2

2 - uracil/thymidine): a. the template strand b. the...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online