{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}


LS4_11_MolGen2 - LS4 Final Exam announcements Thursday Sept...

Info iconThis preview shows pages 1–12. Sign up to view the full content.

View Full Document Right Arrow Icon
LS4 Final Exam announcements Thursday, Sept 10, 8:00-11:00 a.m. Sections 2B, 2C, 2D in MS 4000A TA: Aditi, Deepthi (2C) Sections 2A, 2E, 2F in CS 76 TA: Mohsin, Deepthi (2E)
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Must have photo ID. NO GRAPHING CALCULATORS!!! NO drinks, food, hats. No cell phones; all personal items to the front of the room. Emergency bathroom visits will be escorted. No other questions answered while only 1 proctor in the room. LS4 Final Exam announcements
Background image of page 2
DNA Fingerprinting With the exception of identical twins or other clones, each organism has a unique DNA sequence. The two classes of repeat elements can be used to generate a DNA pattern or “fingerprint” that can identify specific individuals. Simultaneous comparison of the genotypic patterns of molecular markers at many different loci can determine the relationship between different individuals. Useful in criminal cases and to determine parentage.
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Any molecular marker can be used for DNA fingerprinting. RFLP , minisatellites (VTNR), microsatellites… - VNTR (variable number of tandem repeats) =minisatellite GCGGACCTATTAAGA GACCTATTAAGAGACCTATTAAGA… - STR (short tandem repeat)= microsatellite ATGCGGT CATCATCATCATCAT TTGACCT (CAT)n DNA Fingerprinting
Background image of page 4
•Variation in size is due to a variable number of repeats , not to a change in the sequence of a restriction site. •Average size of repeats is 2-15kb. •Found very frequently in genomes. Minisatellites (VNTRs)
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
1 1’ 200 bp 180 bp Microsatellites: polymorphic tandem repeats (2-8 bp long) CA, AT, CGA, etc. analyzed by PCR (CA)20 (CA)10
Background image of page 6
Paternity Testing
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Detection of SNPs R estriction f ragment l ength p olymorphisms (RFLPs) - Restriction Digestion/Southern blot • Allele specifc oligonucleotides (ASOs) - PCR ±ollowed by blotting • DNA sequencing
Background image of page 8
• Allele specific oligonucleotides (ASOs)…PCR followed by blotting: Detection of SNPs: ASOs
Background image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
• Allele specifc oligonucleotides (ASOs)… What are the genotypes of the following individuals? Detection of SNPs: ASOs A: Normal ß-globin allele S: Sickle ß-globin allele 1. Blot DNA from each individual twice (2 rows) 2. Probe each row with different ASOs. Probe for normal allele (A) Probe for Sickle allele (S)
Background image of page 10
POSITIONAL CLONING Process of determining a gene from a mutant phenotype.
Background image of page 11

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 12
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

Page1 / 44

LS4_11_MolGen2 - LS4 Final Exam announcements Thursday Sept...

This preview shows document pages 1 - 12. Sign up to view the full document.

View Full Document Right Arrow Icon bookmark
Ask a homework question - tutors are online