Lecture 7 - 1984-Cloning of the Na+ channel: Noda (and 17...

Info iconThis preview shows pages 1–10. Sign up to view the full content.

View Full Document Right Arrow Icon
1 1984--Cloning of the Na + channel: Noda (and 17 others). Brute force biochemistry. Source of abundant protein: eel electric organ. Purify and concentrate the protein: column separation. Cut puriFed protein into small fragments with proteolytic enzymes. Determine terminal amino acids of each fragment by Edman degradation. Make DNA probes based on partial amino acid sequence of each fragment. Screen a cDNA library to Fnd clones that hybridize with the DNA probes. Sequence each clone, and look for overlap. Compile complete cDNA sequence.
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
2 Concentrate protein Starting material
Background image of page 2
3 Concentrate protein Starting material TTX TTX TTX = bead w/ TTX = Na + channel
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
4 Cut purifed protein into small Fragments with proteolytic enzymes, determine the terminal amino acids, design DNA probes From the partial amino acid sequence. EDCTKE SLALL± etc TGTACCTGAGCCTACTGGAT etc
Background image of page 4
5 Making a cDNA library mRNA of interest 1) Isolate all the mRNAs expressed by a tissue
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
6 Making a cDNA library mRNA of interest 2) Make complemenary DNA (cDNA). cDNA of interest
Background image of page 6
7 Making a cDNA library Each plasmid has a different cDNA insert 3) Insert each cDNA into a plasmid, put the plasmid into bacteria, and have the bacteria replicate and make many copies for you.
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
8 Make radiolabeled probe based on the derived sequence of the peptide fragments and screen the cDNA library. Labeled probe recognizes the cDNA of interest
Background image of page 8
9 1987--Cloning of the Frst K + channel gene: Jan lab and other labs: the elegance of genetics. Drosophila mutation called Shaker (shakes when anesthetized) showed lack of a type of K + current in muscle.
Background image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 10
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 09/17/2009 for the course BIO 365R taught by Professor Draper during the Spring '08 term at University of Texas.

Page1 / 33

Lecture 7 - 1984-Cloning of the Na+ channel: Noda (and 17...

This preview shows document pages 1 - 10. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online