{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

img003 - l 10 Chapter 6 When phosphate groups are added...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: l 10 Chapter 6 When phosphate groups are added, these become nucleotides. In the DNA strand, the adjacent nucleotides are connected by phosphodiester bonds that link a phosphate group to both the 3'-carbon atom of the deoxyribose of one nucleotide and the 5' carbon atom of the deoxyribose of the next nucleotide in the chain. b. The information is contained in the order of those building blocks; there are 3 billion nucleotides in the complete haploid set of 23 human chromosomes. This amount of sequence can potentially provide a huge amount of information. Although there are only four different building blocks, they can be combined in a huge number of combinations. For instance, when considering a short 10-nucleotide-long piece of DNA, there are 410 or 1,048,576 different possible sequence permutations. The information may be recognized by proteins that bind directly to DNA (see Chapter 18), or, as you will see in Cha ter 8, it can be copied into 1 RNA to direct synthesis of proteins. c. There are four major differences between DNA and RNA. (1) In RNA, the sugar is ribose instead of deoxyribose. (2) RNA contains the base U instead of T. (3) Most DNA molecules found in nature are double stranded and most RNA molecules are single stranded, but i there are exceptions to both of these cases. (4) DNA strands can be very long—more than 100,000,000 nucleotides in a human chromosome, for example. The longest naturally occurring RNA molecules are much shorter—about 20,000 nucleotides at most. 6-13. The complementary DNA would have the complementary sequence with the opposite polarity. Note also the presence of T in DNA in contrast with U in RNA. Th 3' GGGAACCTTGATGTTTCGGCTCTAATT 5' 6-14. RNA from virus type 1 was mixed with protein from virus type 2 to reconstitute a "hybrid" virus. In a parallel experiment, RNA from virus type 2 was mixed with protein from virus type 1. When these reconstituted hybrid viruses were used to infect cells, the progeny viruses in each case had the protein that corresponded to the type of RNA in the parent hybrid virus. The protein in the progeny did not correspond to the protein in the parent hybrid virus. l 6-15. a. The possibility of finding any particular nucleotide at any position along such a DNA molecule is 1/4. The possibility that a sequence of 6 nucleotides is 5'. . .GAATTC. . .3' would be 1/4 x 1/4 x 1/4 x 1/4 x 1/4 x 1/4 = 1/4096. In other words, this particular sequence of 6 nucleotides would appear on average once every 4096 nucleotides in the DNA molecule. ...
View Full Document

{[ snackBarMessage ]}