F08pages94-114 - Tools Restriction enzymes to precisely cut...

Info iconThis preview shows pages 1–5. Sign up to view the full content.

View Full Document Right Arrow Icon
Tools • Restriction enzymes to precisely cut DNA. • Plasmid vectors to carry DNA. • E. coli bacteria to replicate the DNA. Plasmid (top) E. coli bacteria (bottom) Looking for a needle in a haystack • The human genome is big! 3 x 10 9 base pairs! • A gene is 3 x 10 3 base pairs. • How is it possible to isolate and study a single gene from the genome? Each bacteria strain has a pair of restriction endonuclease and methylation enzymes • Methylase - methylates at a speciFc DNA sequence. • Restriction Endonuclease - Cuts un methylated DNA at the same DNA sequence. Will not cut hemi-methylated or fully methylated DNA. • Host bacterial DNA is protected by methylation. • Incoming unmethylated DNA (e.g., phage) is cut by the restriction endonuclease and cannot replicate. 94
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
DNA replication creates hemi-methylated DNA - methylase restores it to the fully methylated state * 5’-GAATTC-3’ 3’-CTTAAG-5’ * 5’-GAATTC-3’ 3’-CTTAAG-5’ 5’-G 3’-CTTAA AATTC-3’ G-5’ DNA Replication Methylase Restriction Endonuclease 5’-GAATTC-3’ 3’-CTTAAG-5’ * Fully methylated hemimethylated unmethylated Restriction endonuclease/methylase protect bacteria from incoming foreign DNA Methylated ( ) bacterial DNA is not digested by restriction ). Restriction endonuclease digests un methylated phage DNA Yum! Restriction endonucleases are a valuable tool for gene cloning Over a 100 different restriction endonucleases are available and can be used to cut DNA at speci±c sequences. 95
Background image of page 2
Clone restriction endonuclease digested DNA into a plasmid vector GAATTC GAATTC CTTAAG CTTAAG AATTC G G CTTAA GAATTC CTTAAG Eco R1 digestion Eco R1 digestion amp R gene G AATTC G AATTC CTTAA G CTTAA G amp R gene Ligase DNA fragment of the human genome Human DNA Recombinant plasmid After inserting recombinant plasmid into bacteria, can produce large amount of plasmid with fragment of the human genome G AATTC G AATTC CTTAA G CTTAA G amp R gene Ampicillin sensitive bacteria Grow on plates with ampicillin Rare bacteria take up the plasmid and form colonies. Bacterial colonies Analyze restriction endonuclease digested DNA fragments by agarose gel electrophoresis G AATTC G AATTC CTTAA G CTTAA G amp R gene AAGCTT TTCGAA EcoRI HindIII EcoRI 2 kb 3.2 kb 5 kb plasmid + charge - charge 2 kb 3.2 kb 5 kb Agarose gel Digest with EcoRI and HindIII Agarose gel electrophoresis Smaller DNA fragments migrate through the gel faster than bigger fragments. 96
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Determining the DNA sequence of a cloned DNA CAGTCTAAGCCGTGCCCTTAA GCTAGATTAAAGTCCAGAGCCCTTAGAGAGCACATT… GTCAGATTCGGCACGGGA 5’ 3’ universal primer Reaction has: DNA polymerase dATP, dCTP, dTTP, dGTP 4 fluorescent labeled di deoxynucleotide triphosphates ( ddATP , ddCTP , ddTTP , ddGTP ) (just a little bit!) GTCAGATTCGGCACGGGA A GTCAGATTCGGCACGGGAA T GTCAGATTCGGCACGGGAAT T GTCAGATTCGGCACGGGAATT C GTCAGATTCGGCACGGGAATTC G
Background image of page 4
Image of page 5
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 20

F08pages94-114 - Tools Restriction enzymes to precisely cut...

This preview shows document pages 1 - 5. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online