L13 - Review Part I

L13 - Review Part I - Bio 1AL November 24 th , 2008 1)...

Info iconThis preview shows pages 1–24. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Bio 1AL November 24 th , 2008 1) Format of lab exam 2. Resources for lab exam 2. 2) Resources for lab exam 2. 3) Bioinformatics – overview, application. 4) Reproduction and development. Central Dogma DNA RNA PROTEIN 1) Entrez Gene- Homo sapiens (gene and phenotype!) 2) Multiple phenotypes – specific disease, use of OMIM 3) Chromosome location – p (petite arm fr.) 4) Transcript products (alternative splicing, take 1 st ) 5) Translation (Expasy), Codon Table, Mutations 6) Alignment (EBI/BLAST) --5’ ATCCGATCTATCTGGCCATGCTAA 3’—---3’ TAGGCTAGATAGACCGGTACGATT 5’-- 3’ 5’ Template 1? Template 2? DNA Sequence Which strand is the template? What is the reading frame? Virtual Sequence – you don’t know which one initially. Verbose-stop Includes nt seq Codon Table First Position Third Position Second Position U C A G UUU UCU UAU UGU UUC F UCC UAC Y UGC C UUA UCA UAA STOP UGA STOP U UUG L UCG S UAG STOP UGG W U C A G CUU CCU CAU CGU CUC CCC CAC H CGC CUA CCA CAA CGA C CUG L CCG P CAG Q CGG R U C A G AUU ACU AAU AGU AUC ACC AAC N AGC S AUA I ACA AAA AGA A AUG M (I) ACG T AAG K AGG R U C A G GUU GCU GAU GGU GUC GCC GAC D GGC GUA GCA GAA GGA G GUG V GCG A GAG E GGG G U C A G Mutation...
View Full Document

This note was uploaded on 09/28/2009 for the course BIO 1al taught by Professor Pederson during the Fall '08 term at Berkeley.

Page1 / 78

L13 - Review Part I - Bio 1AL November 24 th , 2008 1)...

This preview shows document pages 1 - 24. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online