quiz2prac - MIT Biology Department 7.012 Introductory...

Info iconThis preview shows pages 1–4. Sign up to view the full content.

View Full Document Right Arrow Icon
1 7.012 Practice Quiz 2 2004 Actual Quiz 2 (closed book) will be given Monday 10/25 at 10:00 am No Sections on MONDAY or TUESDAY 10/25-10/26 (No Kidding.) NOTE THE ROOM MAY BE DIFFERENT THAN THE ROOM YOUR WERE ASSIGNED FOR QUIZ 1 Quiz Review Session Thursday, 10/21 7:00 - 9:00 pm Tutoring Session Friday, 10/22 4:00 - 6:00 pm MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
2 Question 1 a) Indicate whether each of the following statements is true or false . If false, correct the statement or provide a brief explanation for why it is false. i) DNA replication is initiated at promoter sequences in the DNA. ii) RNA polymerase requires primers to initiate RNA synthesis. iii) Okazaki fragments are the short fragments of DNA that are produced on the leading strand at the DNA replication fork. iv) The 5' to 3' direction of DNA synthesis implies that deoxyribonucleotides are added to the 5' OH group on the growing strand. v) Transcription is terminated at stop codons in the mRNA. b) Shown below is the DNA sequence of a gene from a virus that encodes a short viral peptide. Also shown is the sequence of the mRNA synthesized from this gene. genomic DNA sequence: 5 ' - AGCTCATGTGCGAGTCCTGACGCTGACTAGG - 3 ' 3 ' - TCGAGTACACGCTCAGGACTGCGACTGATCC - 5 ' mature mRNA sequence (G * = G cap): 5 ' - G * UCAUGUGCGAACGCUGACUAGGAAAAAAAA .... - 3 ' i) In the genomic DNA sequence shown above, draw a box around each of the two exons in the gene. ii) In the mRNA above, some nucleotides are present that are not coded for in the genomic DNA sequence. Name the two processes that have occurred to add these nucleotides to the mRNA. iii) How many amino acids are in the viral peptide encoded by this gene? _______ iv) Is this virus more likely to replicate in prokaryotic or eukaryotic cells? Briefly explain your reasoning.
Background image of page 2
3 U C A G U UUU phe (F) UUC phe (F) UUA leu (L) UUG leu (L) UCU ser (S) UCC ser (S) UCA ser (S) UCG ser (S) UAU tyr (Y) UAC tyr (Y) UAA STOP UAG STOP UGU cys (C) UGC cys (C) UGA STOP UGG trp (W) UC A G C CUU leu (L) CUC leu (L) CUA leu (L) CUG leu (L) CCU pro (P) CCC pro (P) CCA pro (P) CCG pro (P) CAU his (H) CAC his (H) CAA gln (Q) CAG gln (Q) CGU arg (R) CGC arg (R) CGA arg (R) CGG arg (R) UC A G A AUU ile (I) AUC ile (I) AUA ile (I) AUG met (M) ACU thr (T) ACC thr (T) ACA thr (T) ACG thr (T) AAU asn (N) AAC asn (N) AAA lys (K) AAG lys (K) AGU ser (S) AGC ser (S) AGA arg (R) AGG arg (R) U C A G G GUU val (V) GUC val (V) GUA val (V) GUG val (V) GCU ala (A) GCC ala (A) GCA ala (A) GCG ala (A) GAU asp (D) GAC asp (D) GAA glu (E) GAG glu (E) GGU gly (G) GGC gly (G) GGA gly (G) GGG gly (G) U C A G Question 2 The term "central dogma" refers to the flow of biological information from DNA to RNA to protein. DNA RNA Protein 1 2 3 a) i) In the spaces below, indicate the process that corresponds to each arrow. 1. ___________ 2. ___________ 3. ___________ ii) Name the initiation site for each processes, and on which molecule this site exists.
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 4
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 14

quiz2prac - MIT Biology Department 7.012 Introductory...

This preview shows document pages 1 - 4. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online