Final%20Exam%20Key - Biology 20A Final Exam Fall 2008 1 A...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
1 Biology 20A - Final Exam Fall 2008 1. A key part of the experiments of Beadle and Tatum was to isolate strains of Neurospora that were unable to make specific amino acids. How did they identify these strains? a. by looking at the enzymes and seeing which ones were missing b. by growing the cells and determining which amino acid was missing >>>c. by seeing how the strains grew in different types of media that were missing different amino acids d. by mutating the DNA e. by determining which genes were deleted 2. If you synthesized DNA using just two different types of nucleotides (for example just G and A) how many different codons could be made? a. 2 b. 3 c. 4 d. 6 >>>e. 8 3. Find the start codon (for translation) and determine the number of amino acids encoded by this mRNA. agauuuaagggcuggguuuaccuauguugcaucaucaaggg a. none >>>b. 6 c. 9 d.14 e. 28 4. How do viruses make viral coat proteins? >>>a. they use the ribosomes in the cells they infect b. they package ribosomes inside the virus c. the viral genome always encodes its own ribosomes d. they use coat proteins that normally form part of the cell before infection e. they use the proteasome 5. Who first showed that DNA replication was semi conservative? >>>a. Messelson and Stahl b. Hershey and Chase c. Kornberg d. Beadle and Tatum e. Garrod
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
6. What is the role of the “primase” in DNA replication? >>>a. it synthesizes a short piece of RNA, which serves as starting point for replicating the DNA b. it synthesizes a short piece of DNA, which serves as starting point for replicating the DNA c. it opens up the DNA to allow synthesis to begin d. it makes pieces of DNA called Okasaki fragments e. it prevents the single strands of DNA from coming back together 7. What molecules are used by DNA polymerase to make DNA? a. aminoacyl tRNA’s b. deoxynucleotide monophosphates c. nitrogenous bases >>>d. dATP, dTTP, dCTP, dGTP e. amino acids 8. If mistakes are made in the synthesis of DNA, most can be corrected by the “proofreading activity” of which enzyme? a. primase b. helicase >>>c. DNA polymerase d. ligase e. DNA endonuclease 9. Regarding mutation, which of the following is not correct? >>>a. a point mutation will cause a shift in the reading frame b. breaking and rejoining chromosomes can cause mutations c. many point mutations do not change the amino acid sequence of a protein d. deletion of a single nucleotide is more likely to disrupt a gene than changing a G to a T e. ultraviolet light can cause mutations 10. People with the disease Xeroderma pigmentosa have extreme sensitivity to UV light. What is the molecular basis of this disease? a. a defect in DNA replication b. a defect in the regulation of cell division c. a defect in pigment production d. a defect in a tumor suppressor gene >>>e. a defect in DNA repair 11. When DNA is made by the Polymerase Chain Reaction (PCR) how are the two strands of the DNA double helix made to separate? a. by a heat-resistant helicase
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 10/24/2009 for the course BIO bIO taught by Professor Bowman during the Winter '07 term at École Normale Supérieure.

Page1 / 10

Final%20Exam%20Key - Biology 20A Final Exam Fall 2008 1 A...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online