Lecture 5 C. elegans 09

Lecture 5 C. elegans 09 - Advantages of C. elegans: 1....

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Advantages of C. elegans: 1. rapid life cycle 2. hermaphrodite 3. prolific reproduction 4. transparent 5. only ~1000 cells 6. laser ablation 7. complete cell lineage map 8. genetics Gene silencing and RNA viruses share potential to produce dsRNA Fire and Mello (1998, Nature) used C. elegans to prove that dsRNA inhibits expression of endogenous genes homologous to that dsRNA Double stranded GFP RNA interferes with expression of GFP in transgenic C. elegans GFP expressed in nuclei Fire and Mello (1998, Nature) After adding dsRNA for GFP Transgenic C. elegans express GFP in cell nuclei. Adding tiny amounts of GFP dsRNA into gut stops expression of GFP in animals of the next generation. Features of RNAi Induced by dsRNA with homology to exons Target sequence specific Catalytic: very small amounts of ds RNA are sufficient Spreads: injection into gut silences genes in embryos Lasts: Silencing continues as the embryo matures Small RNAs produced – homologous to original dsRNA Mechanism of RNAi Dicer binds dsRNA and cleaves making siRNA siRNAs bind to ARGONAUTE to make RISC complex. The RISC complex binds homologous RNAs and cleaves them. Amplification and spread Verdel et al 2009 Fig 1. Amplification RDRP copies mRNA making more ds RNA. Dicer cuts that generating more siRNA More RDRP is activated and more dsRNA is made. Spread to other cells Current guess: certain classes of small RNAs transported between cells Block transcription of homologous genes Dicer binds dsRNA and cleaves making siRNA siRNAs bind to ARGONAUTE to make RITS complex. The RITS complex binds homologous DNA or RNA and promotes chromatin condensation. Verdel et al 2009 Fig 1. RITS complex Nuclear RITS complex directs methylation of histones on target genes while they are being expressed. Alternative models for RITS complex methylating histones on target locus Genomic DNA is wrapped around histone proteins to make nucleosomes. Methylation of histones increases the condensation of chromosomal DNA making it less accessible to transcription factors Methylation patterns are copied when DNA is replicated Stable block to transcription Verdel et al 2009 Fig 2. Centromeres have condensed chromatin and highly methylated DNA. Pol IV is recruited to transcribe repeated sequences in centromeres. The production of double stranded RNAs maintains the condensed state of the centromeres. Blue are common repeats and orange are retrotransposons Short RNA homologous to common repeats can be isolated In Arabidopsis, small RNA production depends on functional PolIV Chromatin condensation blocks transcription RITS complex recruits other chromosome binding proteins to promote chromatin condensation RITS complex Verdel et al 2009 Fig 3. A special RNA polymerase produces transcripts in condensed regions of DNA such as centromeres initiating and maintaining chromatin condensation Verdel et al 2009 Fig 4a. Mechanisms of RNAi Dicing Base pairing Slicing Amplification Spread to other cells Block transcription of homologous genes Dicer RISC/Argonaut RISC/Argonaut RdRp Small dsRNA RITS Sources of dsRNA Ds RNA viruses Transposable element inverted repeats Transcripts copied by RdRp Transcripts produced by PolIV (plants) miRNAs Overlapping mRNA transcripts MIRNA gene Pol II 5 ’ AUGAGAGAGU CU |:|||||||| || U CC UU 3 ’ UGCUCUCUCA GA CUAUAACCG GCCGAGU AGUCUA CU C U C C GAUAUUGGC UGGUUCA UCAGAU ||||||||| :||:||| |||||| 4 4nt lo o p MIRNA genes are PolII genes that encode a hairpin shaped mRNA. Dicer cleaves the double stranded portion to make a short dsRNA. That combines with the RISC complex and directs cleavage of a specific target mRNA AAA DCL1 HYL1 CC UU C C 5 ’ AUGAGAGAGU CU GAUAUUGGC UGGUUCA UCAGAU |:|||||||| || ||||||||| :||:||| |||||| 4 4nt lo o p 3 ’ UGCUCUCUCA GA CUAUAACCG GCCGAGU AGUCUA U CU C U DCL1 HEN1, HYL1 ~200 MI RNA ge s** ne 57 uniquem iRNAs from26 fam s ilie C C 5' UAUUGGC UGGUUCA UCACU 3' ||||||| ||||||| ||| 3' CUAUAACCG GCCGAGU AGU 5' C U HASTY C C 5' UAUUGGC UGGUUCA UCACU 3' ||||||| ||||||| ||| 3' CUAUAACCG GCCGAGU AGU 5' C U miRNA Precursor Transcript RISC AGO1 components UAUUGGCCUGGUUCACUCCACU 5 ’ Cap Poly(A) tail miRNA* m7Gppp N AAAAA CUAUAACCGCGCCGAGUUAGU AGO1 RISC miRNA Target ..... ............. CUAUAACCGCGCCGAGUUAGU I ntrons AAA AGO1 **C ulativedata fromBarte Carrington, Che We l, Zhu, othe um ls, n, ige rs Cleaved target AAA Overlapping transcripts on opposite strands can generate small RNAs Controlled expression of the opposing transcripts lead to RNA mediated silencing Regulate protein levels Small RNA regulation of salt stress response Salt stress induces ROS and increases in proline. High proline protects cells against water loss. Increased ROS leads to induction of an SRO5 transcript that overlaps the P5CDH transcript As a result, RNAi is initiated against P5CDH transcripts. P5CDH protein levels drop and proline accumulates Borsani et al 2005 Cell 123, 1279 Summary Small double stranded RNAs regulate gene expression by: directing degradation of specific transcripts preventing translation of specific transcripts promoting chromatin condensation of specific target genes Double stranded RNA can be used to mimic mutations in C. elegans and in other organisms. Sequence-specific targets Effect will be carried on in the progeny of treated animals Double stranded GFP RNA interferes with expression of GFP in transgenic C. elegans GFP expressed in nuclei After adding dsRNA for GFP How would you design a genetic screen to identify the genes involved in the RNAi mechanism? A real genetic screen for C. elegans genes essential for RNAi Ref: Tabara et al 1999 Cell 99, 123-132. On class web page. A real genetic screen for C. elegans genes essential for RNAi Candidate mutants isolated after feeding E. coli producing double stranded RNA How could double stranded RNA be made in E. coli? Checked candidate mutants by microinjection into gut The listed mutants passed the secondary test Different mutants had specific phenotypes for activation of transposable elements and silencing of transgenes Functions of genes in RNAi decifered Rde4 = Initiating RNA binding protein Rde1 = Argonaut Rde2 = RISC complex Mut7 = endonuclease RNA is a gene regulator as well as a carrier of information ...
View Full Document

Ask a homework question - tutors are online