Problem Set 4

Problem Set 4 - Name_ TA/Section_ 7.012 Problem Set 4...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Name_________________________________________ TA/Section_______________________ 7.012 Problem Set 4 Please print out this problem set and answer the questions on the print out. Answers to this problem set are to be turned in at the box outside 68-120 by 4:00, Friday, Oct. 19. Problem sets will not be accepted late. Solutions will be posted at: http://stellar.mit.edu/S/course/7/fa07/7.012/index.html Question 1 The figures on the following two pages represent gene 1. Figure 1 is the genomic sequence near the gene 1 locus, and figure 2 is an alignment of the genomic sequence with the mRNA synthesized from gene 1. GGACCGCGGGGCAGGATTGCTCCGGGCTGTTTCATGACTTGTCAGGTGGGATGACTTGGATGGAAAAGTAGAAGGTCATG 1 +---------+---------+---------+---------+---------+---------+---------+--------- CCTGGCGCCCCGTCCTAACGAGGCCCGACAAAGTACTGAACAGTCCACCCTACTGAACCTACCTTTTCATCTTCCAGTAC GGGTGGCCAACTTGGGCGAGAAAAGGTATATAAAGGTCTCTTGCTCCCATCAACTGCCTCAAAAGTAGGTATTCCAGCAG 81 +---------+---------+---------+---------+---------+---------+---------+--------- CCCACCGGTTGAACCCGCTCTTTTCCATATATTTCCAGAGAACGAGGGTAGTTGACGGAGTTTTCATCCATAAGGTCGTC ATCAGACAACGTCAGGTGGGATGACTTGGATGGAAAAGTAGAAGGTCATGACCAACCTCTTCCAATCCAACCACAAACA 161 +---------+---------+---------+---------+---------+---------+---------+--------- TAGTCTGTTGCAGTCCACCCTACTGAACCTACCTTTTCATCTTCCAGTACTGGTTGGAGAAGGTTAGGTTGGTGTTTGT AAAATCAGCCAATATGTCCGACTTCGAGAACAAGAACCCCAACAACGTCCTTGGCGGACACAAGGCCACCCTTCACAACC 241 +---------+---------+---------+---------+---------+---------+---------+--------- TTTTAGTCGGTTATACAGGCTGAAGCTCTTGTTCTTGGGGTTGTTGCAGGAACCGCCTGTGTTCCGGTGGGAAGTGTTGG CTAGTATGTATCCTCCTCAGAGCCTCCAGCTTCCGTCCCTCGTCGACATTTCCTTTTTTTTCATATTACATCCATCCAAG 321 +---------+---------+---------+---------+---------+---------+---------+--------- GATCATACATAGGAGGAGTCTCGGAGGTCGAAGGCAGGGAGCAGCTGTAAAGGAAAAAAAAGTATAATGTAGGTAGGTTC TCCCACAATCCATGACTAACCAGAAATATCACAGATGTTTCCGAGGAAGCCAAGGAGCACTCCAAGAAGGTGCTTGAAAA 401 +---------+---------+---------+---------+---------+---------+---------+--------- AGGGTGTTAGGTACTGATTGGTCTTTATAGTGTCTACAAAGGCTCCTTCGGTTCCTCGTGAGGTTCTTCCACGAACTTTT CGCCGGCGAGGCCTACGATGAGTCTTCTTCGGGCAAGACCACCACCGACGACGGCGACAAGAACCCCGGAAACGTTGCGG 481 +---------+---------+---------+---------+---------+---------+---------+--------- GCGGCCGCTCCGGATGCTACTCAGAAGAAGCCCGTTCTGGTGGTGGCTGCTGCCGCTGTTCTTGGGGCCTTTGCAACGCC GAGGATACAAGGCCACCCTCAACAACCCCAAAGTGTCCGACGAGGCCAAGGAGCACGCCAAGAAGAAGCTTGACGGCCTC 561 +---------+---------+---------+---------+---------+---------+---------+--------- CTCCTATGTTCCGGTGGGAGTTGTTGGGGTTTCACAGGCTGCTCCGGTTCCTCGTGCGGTTCTTCTTCGAACTGCCGGAG GAGTAAGCTCAGAGTTCACGAAAGAACCATTCGACGAGGGGAAGCACGGGGTTATCTCGTTCGAAACATGGGCCTGGTTA 641 +---------+---------+---------+---------+---------+---------+---------+--------- CTCATTCGAGTCTCAAGTGCTTTCTTGGTAAGCTGCTCCCCTTCGTGCCCCAATAGAGCAAGCTTTGTACCCGGACCAAT ATGCAAATGCATAATGGGGAGGATAATGAATCATGAGGTGTACGATATGGACGATATTGACGGATCTTAATTTGATGACA 721 +---------+---------+---------+---------+---------+---------+---------+---------
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 9

Problem Set 4 - Name_ TA/Section_ 7.012 Problem Set 4...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online