Final Fall 07 - Name_ID BIS101-01 Fall 2007 Dr D J...

Info icon This preview shows pages 1–5. Sign up to view the full content.

View Full Document Right Arrow Icon
Name: ______________________________                          ID: _______________________________ BIS101-01, Fall 2007 Dr. D. J. Kliebenstein, Instructor Final Exam Please print your name and ID number on each page of the exam. The exam has 10 questions and a total of 160 points. For full credit, show all of your work. For written answers, write in complete sentences that are as well written as possible. AUTHORIZATION FOR PUBLIC DISTRIBUTION OF GRADES I, ___________________________, student ID No.________________________________: authorize the University to publicly distribute my exam grade and my course grade for BIS101-02, by the last 6 digits of my ID number. Signed: ________________________________ Dated: _______________ 1
Image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Name: ______________________________                          ID: _______________________________ 1 __________ 2 __________ 3 __________ 4 __________ 5 __________ 6 __________ 7 __________ 8 __________ 9 __________ 10 __________ Total __________ 2
Image of page 2
Name: ______________________________                          ID: _______________________________ 1. (20 points total /2 pts each) For each phrase on the left, choose the number of the best matching term on the right. a. Can cause a C to mutate to T ___________________ 1. mismatch repair 2. photoreactivation repair protein b. Polymerase that is not error prone ___________________________ 3. transitions 4. forming purine dimmers 5. transversions c. DNA that can cause insertion mutants and deletions ______________ 6. forming pyrimidine dimers 7. Photolyase d. (T to A) or (G to T) mutations are _____________________ 8. deamination 9. transposons e. Blue light primarily repairs DNA by ______________ 10. gap repair 11. 3’ to 5’ exonuclease f. The protein that uses light to directly repair DNA is ________________12. alkylating DNA 13. TTAGAAGAAGAAGAAGAACTT g. This sequence contains a start codon ___________________ 14. endoreduplication repair 15. SOS repair h. Slipped mispairing could cause an indel in any___________________ 16. microsatellite 17. TTATCGATGCTACGTT i. This activity prevents mutations during replication ____________ 18. p53 protein 19. DNA Polymerase I j. Susceptible to Tumor Suppressor mutations ______________ 20. TAQ DNA Polymerase 21. spoofreading repair 2. We discussed two major classes of cancer mutations that are being studied. What are these two classes and how do they fit into the idea of Mendelian idea of dominant and recessive? Give one example of each and state which of the three cancer preventing biological processes that your example affects (10 points). Mutation Class 1 – Mutation Class 2 – 3
Image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Name: ______________________________                          ID: _______________________________ 3. A researcher and her relatives are studying the genetic linkage for three traits in Abominable Snowmen. All three traits are known to be on the largest autosomal chromosome. The three traits are Grinchy versus Gregarious behaviour (G v g), Abominable
Image of page 4
Image of page 5
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern