Final Fall 07 - Answer_Key - Name_ID BIS101-01 Fall 2007 Dr...

Name: ______________________________                          ID: _______________________________
BIS101-01, Fall 2007
Dr. D. J. Kliebenstein, Instructor
Final Exam
Please print your name and ID number on each page of the exam.
The exam has 10 questions and a total of 160 points.
For full credit, show all of your work.
For written answers, write in complete sentences that are as well written as possible.
AUTHORIZATION FOR PUBLIC DISTRIBUTION OF GRADES
I, _______________________________, student ID No.__________________________________:
authorize the University to publicly distribute my exam grade and my course grade for BIS101-02, by the last 6
digits of my ID number.
Signed: ________________________________ Dated: _______________
1

Name: ______________________________                          ID: _______________________________
1 ____ _ _____
2 ________
3 __________
4 __________
5 _________
6 __________
7 __________
8 __________
9 __________
10 __________
Total _________
2

Name: ______________________________                          ID: _______________________________
1. (20 points/ 2 points per line) For each phrase on the left, choose the number of the best matching term on the
right.
a. Can cause a C to mutate to T _______ 8 _____________ 1. mismatch repair
2. photoreactivation repair protein
b. Polymerase that is not error prone __________ 19 _________________3. transitions
4. forming purine dimers
c. DNA that can cause insertion mutants and deletions ____13 ___9______ 5. transversions
6. forming pyrimidine dimers
7. Photolyase
d. (T to A) or (G to T) mutations are _______ 5 ______________ 8. deamination
9. transposons
e. Blue light primarily repairs DNA by _____ 7 _________ 10. gap repair
11. 3’ to 5’ exonuclease
f. The protein that uses light to directly repair DNA is_______ 7 ________ 12. alkylating DNA
13. TTAGAAGAAGAAGAAGAACTT
g. This sequence contains a start codon __________ 17 _______ 14. endoreduplication repair
15. SOS repair
h. Slipped mispairing could cause an indel in any__________ 16 _______ 16. microsatellite
17. TTATCGATGCTACGTT
i. This activity prevents mutations during replication _____ 11 _____ 18. p53 protein
19. DNA Polymerase I
j. Susceptible to tumor suppressor mutations _______18______ 20. TAQ DNA Polymerase
21. spoofreading repair
2. We discussed two major classes of cancer mutations that are being studied. What are these two classes and
how do they fit into the idea of Mendelian idea of dominant and recessive? Make sure to state what the
dominant or recessive nature of the mutation suggests about the genes original function. Give one example of
each and state which of the three cancer preventing biological processes that your example affects (10 points).
Mutation Class 1 – One type of cancer mutation is the tumor suppressor mutation. This mutation is
typically recessive suggesting that the wildtype copy functions to suppress cancerous cells . Examples
would include Rb or p53, both of which block the cell cycle. In addition, p53 can trigger apoptosis.
Mutation Class 2 – The second major class of cancer mutation is the oncogenic mutation . This is a
dominant gain-of-function mutation that leads to cancerous growth. Because it is dominant, it is not
possible to deduce the wildtype function of these genes. Examples would be the growth factor receptor
or BCRZ or BCR2 that function to block apoptosis.