{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

Final Fall 07 - Answer_Key

Final Fall 07 - Answer_Key - Name_ID BIS101-01 Fall 2007 Dr...

Info iconThis preview shows pages 1–4. Sign up to view the full content.

View Full Document Right Arrow Icon
Name: ______________________________                          ID: _______________________________ BIS101-01, Fall 2007 Dr. D. J. Kliebenstein, Instructor Final Exam Please print your name and ID number on each page of the exam. The exam has 10 questions and a total of 160 points. For full credit, show all of your work. For written answers, write in complete sentences that are as well written as possible. AUTHORIZATION FOR PUBLIC DISTRIBUTION OF GRADES I, _______________________________, student ID No.__________________________________: authorize the University to publicly distribute my exam grade and my course grade for BIS101-02, by the last 6 digits of my ID number. Signed: ________________________________ Dated: _______________ 1
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Name: ______________________________                          ID: _______________________________ 1 ____ _ _____ 2 ________ 3 __________ 4 __________ 5 _________ 6 __________ 7 __________ 8 __________ 9 __________ 10 __________ Total _________ 2
Background image of page 2
Name: ______________________________                          ID: _______________________________ 1. (20 points/ 2 points per line) For each phrase on the left, choose the number of the best matching term on the right. a. Can cause a C to mutate to T _______ 8 _____________ 1. mismatch repair 2. photoreactivation repair protein b. Polymerase that is not error prone __________ 19 _________________3. transitions 4. forming purine dimers c. DNA that can cause insertion mutants and deletions ____13 ___9______ 5. transversions 6. forming pyrimidine dimers 7. Photolyase d. (T to A) or (G to T) mutations are _______ 5 ______________ 8. deamination 9. transposons e. Blue light primarily repairs DNA by _____ 7 _________ 10. gap repair 11. 3’ to 5’ exonuclease f. The protein that uses light to directly repair DNA is_______ 7 ________ 12. alkylating DNA 13. TTAGAAGAAGAAGAAGAACTT g. This sequence contains a start codon __________ 17 _______ 14. endoreduplication repair 15. SOS repair h. Slipped mispairing could cause an indel in any__________ 16 _______ 16. microsatellite 17. TTATCGATGCTACGTT i. This activity prevents mutations during replication _____ 11 _____ 18. p53 protein 19. DNA Polymerase I j. Susceptible to tumor suppressor mutations _______18______ 20. TAQ DNA Polymerase 21. spoofreading repair 2. We discussed two major classes of cancer mutations that are being studied. What are these two classes and how do they fit into the idea of Mendelian idea of dominant and recessive? Make sure to state what the dominant or recessive nature of the mutation suggests about the genes original function. Give one example of each and state which of the three cancer preventing biological processes that your example affects (10 points). Mutation Class 1 – One type of cancer mutation is the tumor suppressor mutation. This mutation is typically recessive suggesting that the wildtype copy functions to suppress cancerous cells . Examples would include Rb or p53, both of which block the cell cycle. In addition, p53 can trigger apoptosis. Mutation Class 2 – The second major class of cancer mutation is the oncogenic mutation . This is a dominant gain-of-function mutation that leads to cancerous growth. Because it is dominant, it is not possible to deduce the wildtype function of these genes. Examples would be the growth factor receptor or BCRZ or BCR2 that function to block apoptosis.
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 4
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}