Final Spring 07

Final Spring 07 - Name_ID BIS101-01 Spring 2007 Dr D J...

Info iconThis preview shows pages 1–4. Sign up to view the full content.

View Full Document Right Arrow Icon
Name: ______________________________                          ID: _______________________________ BIS101-01, Spring 2007 Dr. D. J. Kliebenstein, Instructor Final Exam Please print your name and ID number on each page of the exam. The exam has 10 questions and a total of 160 points. For full credit, show all of your work. For written answers, write in complete sentences that are as well written as possible. AUTHORIZATION FOR PUBLIC DISTRIBUTION OF GRADES I, _______________________________, student ID No.__________________________________: authorize the University to publicly distribute my exam grade and my course grade for BIS101-02, by the last 6 digits of my ID number. Signed: ________________________________ Dated: _______________ 1
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Name: ______________________________                          ID: _______________________________ 1 ____ _ _____ 2 ________ 3 __________ 4 __________ 5 _________ 6 __________ 7 __________ 8 _________ 9 __________ 10 __________ Total _________ 2
Background image of page 2
Name: ______________________________                          ID: _______________________________ 1. (20 points total /2 pts each) For each phrase on the left, choose the number of the best matching term on the right. a. (T to C) or (A to G) mutations are ___________________ 1. mismatch repair 2. photoreactivation repair protein b. Polymerase that is error prone ___________________________ 3. transitions 4. forming purine dimmers 5. transversions c. The repair system that creates new DNA_________________ 6. forming pyrimidine dimers 7. Photolyase d. (T to A) or (G to T) mutations are _____________________ 8. error primed repair 9. transcription mutations e. Ultraviolet light primarily damages DNA by ______________ 10. gap repair 11. excision repair f. The protein that uses light to directly repair DNA is ________________12. alkylating DNA 13. TTAGAAGAAGAAGAAGAACTT g. This sequence could cause slipped mispairing ___________________14. endoreduplication repair 15. SOS repair h. Slipped mispairing could cause an indel in any___________________ 16. microsatellite 17. TTATCGATGCTACGTT i. This is important to prevent mutations during replication ____________18. p53 protein 19. DNA Polymerase j. Mutations in this repair system lead to Colon Cancer ______________ 20. TAQ DNA Polymerase 21. spoofreading repair 2. We discussed two major classes of cancer mutations that are being studied. What are these two classes and
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 4
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

Page1 / 11

Final Spring 07 - Name_ID BIS101-01 Spring 2007 Dr D J...

This preview shows document pages 1 - 4. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online