Final Spring 07 - Answer_Key

Final Spring 07 - Answer_Key - Name ID BIS101-01 Spring...

Info iconThis preview shows pages 1–4. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Name: ______________________________ ID: _______________________________ BIS101-01, Spring 2007 Dr. D. J. Kliebenstein, Instructor Final Exam Please print your name and ID number on each page of the exam. The exam has 10 questions and a total of 160 points. For full credit, show all of your work. For written answers, write in complete sentences that are as well written as possible. AUTHORIZATION FOR PUBLIC DISTRIBUTION OF GRADES I, _______________________________, student ID No.__________________________________: authorize the University to publicly distribute my exam grade and my course grade for BIS101-02, by the last 6 digits of my ID number. Signed: ________________________________ Dated: _______________ 1 Name: ______________________________ ID: _______________________________ 1 ____ _ _____ 2 ________ 3 __________ 4 __________ 5 _________ 6 __________ 7 __________ 8 __________ 9 __________ 10 __________ Total _________ 2 Name: ______________________________ ID: _______________________________ 1. (20 points/ 2 points per line) For each phrase on the left, choose the number of the best matching term on the right. a. (T to C) or (A to G) mutations are _______ 3 _____________ 1. mismatch repair 2. photoreactivation repair protein b. Polymerase that is error prone __________ 20 _________________ 3. transitions 4. forming purine dimers c. The repair system that creates new DNA_______ 15 __________ 5. transversions 6. forming pyrimidine dimers 7. Photolyase d. (T to A) or (G to T) mutations are _______ 5 ______________ 8. error primed repair 9. transcription mutations e. Ultraviolet light primarily damages DNA by _____ 6 _________ 10. gap repair 11. excision repair f. The protein that uses light to directly repair DNA is_______ 7 ________ 12. alkylating DNA 13. TTAGAAGAAGAAGAAGAACTT g. This sequence could cause slipped mispairing __________ 13 _______14. endoreduplication repair 15. SOS repair h. Slipped mispairing could cause an indel in any__________ 16 _______ 16. microsatellite 17. TTATCGATGCTACGTT i. This is important to prevent mutations during replication _____ 19 _____18. p53 protein 19. DNA Polymerase j. Mutations in this repair system lead to Colon Cancer _______1______ 20. TAQ DNA Polymerase 21. spoofreading repair 2. We discussed two major classes of cancer mutations that are being studied. What are these two classes and how do they fit into the idea of Mendelian idea of dominant and recessive? Make sure to state what the dominant or recessive nature of the mutation suggests about the genes original function. Give one example of each and state which of the three cancer preventing biological processes that your example affects (16 points)....
View Full Document

This document was uploaded on 11/17/2009.

Page1 / 10

Final Spring 07 - Answer_Key - Name ID BIS101-01 Spring...

This preview shows document pages 1 - 4. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online