Prospero_genomic_seq

Prospero_genomic_seq - Prospero genomic region...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
Prospero genomic region >chr3R:7194709-7197809 cttaaaattaatagttgtaaagaaaaccttagtaattaataaccaaaaacaaccccctaatttcctca gtgtaccaaatctccccttgctctcgagctatattttgcgatcatcagctgttggctgtggcgatcgt ttccttccgcatccgtattggcataggggctgcagattttttctcgatttcgcgttgctcttcgtgat ttcccccgcaccatttgtccattttccgtttccagcgaatctcagctcgccagattgctttttaatct cgcagaatggatctttgaagcggaatcgtaatgcctaattgccactagttcgtttttgggacagtttt ttgttttaacggattttagggtcacttgaccgtaacacaataccaaactataccccaccccccgcaac acgaccagtgggctctttatgagccaaagcatattttaatgatgacacccgaccacgagaaggatagt atgtacggaacacatggccgtgccacactttggtcgtttgtgcgatgagtacattaccgtgtgccgcg atctgtgaaggcacattccaaagcacactttgagatatatgcatgtatgtttgtatattcataccccg acactgccccgtctatgaaacccaggcgcctccctcatttccagcgcatgcaaagtatccgaagttag cgttttccatccatcggagcatcggaacatgaacggaaaatgtgttaaggtcgtaattatctgcgctg tcgtttgtaggtggaagttcgcctcagctggcaactttctttgctcctcgttctcctttcttctcctc ggccagcaccatatggtggccctccatttactccttgcggggttgaagctagagaaagaaaggcccat tgataacgctcctagaccgaagcaagcccataccaaggtgcattgaacttgggattgccaactgtttc
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 11/25/2009 for the course BI 379 taught by Professor Kavaler during the Spring '09 term at Colby.

Ask a homework question - tutors are online