MolecularBio - SOX1 (for Sex determining region Y-box 1) is...

Info iconThis preview shows pages 1–4. Sign up to view the full content.

View Full Document Right Arrow Icon
SOX1 (for Sex determining region Y-box 1 ) is a transcription factor in the Sox protein family. SOX1 expression is restricted to neuroectoderm in the tetrapod embryo. SOX1 is involved in early central nervous system development, where it is functionally redundant with SOX3 and to a lesser degree SOX2 , and maintainance of neural progenitor cell identity. SOX1 is expressed particularly in the ventral striatum , and Sox1-deficient mice have altered striatum development, leading e.g. to epilepsy . A) Basic Position of the Gene and its Sequence 1) Chromosome Coordinates Start: 111,769,914 bp from pter End: 111,774,021 bp from pter Size: 4,108 bases Promoter Sequence >hg18_knownGene_uc001vsb.1 range=chr13:111769914-111769973 5'pad=0 3'pad=0 strand=+ repeatMasking=none CCGGCCGTCTATGCTCCAGGCCCTCTCCTCGCGGTGCCGGTGAACCCGCC AGCCGCCCCG Intron structure
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Exon structure Id Chromosome Contig Strand Exon Start Exon End 6656 13 + 111769914 111769973 6656 13 + 111769974 111771149 6656 13 + 111771150 111774021 Splicing Variants Other Genes in vicinity Rho guanine nucleotide exchange factor is upstream of my gene. It plays a fundamental role in numerous cellular processes triggered by extracellular stimuli that work through G protein coupled receptors. The tubulin, gamma complex associated protein 3 is located downstream of my SOX1 gene. 2) mRNA sequence >uc001vsb.1 (SOX1) length=4108 ccggccgtctatgctccaggccctctcctcgcggtgccggtgaacccgccagccgccccg atgtacagcatgatgatggagaccgacctgcactcgcccggcggcgcccaggcccccacg aacctctcgggccccgccggggcgggcggcggcgggggcggaggcgggggcggcggcggc
Background image of page 2
ggcgggggcgccaaggccaaccaggaccgggtcaaacggcccatgaacgccttcatggtg tggtcccgcgggcagcggcgcaagatggcccaggagaaccccaagatgcacaactcggag atcagcaagcgcctgggggccgagtggaaggtcatgtccgaggccgagaagcggccgttc atcgacgaggccaagcggctgcgcgcgctgcacatgaaggagcacccggattacaagtac cggccgcgccgcaagaccaagacgctgctcaagaaggacaagtactcgctggccggcggg ctcctggcggccggcgcgggtggcggcggcgcggctgtggccatgggcgtgggcgtgggc gtgggcgcggcggccgtgggccagcgcctggagagcccaggcggcgcggcgggcggcggc tacgcgcacgtcaacggctgggccaacggcgcctaccccggctcggtggcggcggcggcg gcggccgcggccatgatgcaggaggcgcagctggcctacgggcagcacccgggcgcgggc ggcgcgcacccgcacgcgcaccccgcgcacccgcacccgcaccacccgcacgcgcacccg cacaacccgcagcccatgcaccgctacgacatgggcgcgctgcagtacagccccatctcc aactcgcagggctacatgagcgcgtcgccctcgggctacggcggcctcccctacggcgcc gcggccgccgccgccgccgctgcgggcggcgcgcaccagaactcggccgtggcggcggcg gcggcggcggcggccgcgtcgtcgggcgccctgggcgcgctgggctctctggtgaagtcg gagcccagcggcagcccgcccgccccagcgcactcgcgggcgccgtgccccggggacctg cgcgagatgatcagcatgtacttgcccgccggcgaggggggcgacccggcggcggcagca
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 4
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 10/15/2009 for the course SDF sdaf taught by Professor Sdfsdf during the Spring '09 term at École Normale Supérieure.

Page1 / 9

MolecularBio - SOX1 (for Sex determining region Y-box 1) is...

This preview shows document pages 1 - 4. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online