class16.final

class16.final - Possible Causes of Within-Sex Individual...

Info iconThis preview shows pages 1–7. Sign up to view the full content.

View Full Document Right Arrow Icon
Possible Causes of Within-Sex Individual Differences Mechanisms designed to produce different outputs depending on current circumstances (e.g., different strategies based on own attractiveness, resources, etc.) Facultative developmental processes: Different mechanisms develop depending on exposure to different environmental inputs Developmental noise, accidents (e.g., greater exposure to prenatal androgens) Heritable differences (different genes in different individuals)
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Heritability and Individual Differences Heritability is an estimate of the fraction of differences between individuals that is due to genetic (vs. environmental) differences e.g., do two individual differ in height due to different genes, different environments (e.g., nutrition), or some combination? Universal traits have a heritability close to zero Number of arms has a heritability of zero (practically) Yet number of arms is still strongly under “genetic control” Heritability does not index the importance of genes for development Evolutionary psychology tends to study species-typical (design universal) mechanisms with low heritability (“behavior genetics” focuses on individual differences) Any individual’s phenotype is always a joint product of genetic and environmental influences; heritability only makes sense with respect to individual differences
Background image of page 2
Heritability and Pubertal Timing/SOI Heritability estimated from designs that compare MZ twins to DZ twins, adopted to full siblings, MZ twins reared apart, etc. Such studies suggest at least half of variance in women’s pubertal timing explained by genetic effects Limited data, but some research also points to SOI scores have substantial heritability Still possible that developmental events like father absence may account for additional variance not explained by genetic effects
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Heritability and Specific Genes Are there specific genes that differ in individuals that may predict individual differences in mating psychology, physiology, and behavior? Androgen receptor gene – may calibrate whole suites of functional mechanisms within organism
Background image of page 4
Specific Genes and Individual Differences (Androgen Receptor Gene) Androgen receptor (AR) gene encodes for the androgen receptor Androgen Receptor: Testosterone binds to it T/receptor complex then binds to DNA and regulates other genes Allows testosterone to turn on/off whole suites of other genes This is how testosterone produces sex differences during development
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Androgen Receptor Gene AR gene is highly “polymorphic” (many different versions of the gene in the population) CAG repeat is variable in #: CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG # of repeats varies from 9-31 in normal range Short # of repeats associated with more active receptors Long # of repeats associated with less active receptors With short repeats, the same levels of testosterone get mapped into larger effects than with long repeats
Background image of page 6
Image of page 7
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 28

class16.final - Possible Causes of Within-Sex Individual...

This preview shows document pages 1 - 7. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online