Pin1L shrna sequences

Pin1L shrna sequences - Details for RMM4532-NM_001033768...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
Details for RMM4532-NM_001033768 Details Sequence Tools and Links Related Items Color Codes: mir-30 context sense loop antisense Hairpin sequence for V2LMM_241899 TGCTGTTGACAGTGAGCG AGCCGGGAATACTACTTCAATC TAGTGAAGCCACAGATGTA GATTGAAGTAGTATTCCCGGCC TGCCTACTGCCTCGGA Mature Sense for V2LMM_241899 CCGGGAATACTACTTCAAT Mature Antisense for V2LMM_241899 ATTGAAGTAGTATTCCCGG Hairpin sequence for V2LMM_189721 TGCTGTTGACAGTGAGCG AGCCCGGCTGGAAGAAGTATAT TAGTGAAGCCACAGATGTA ATATACTTCTTCCAGCCGGGCG TGCCTACTGCCTCGGA Mature Sense for V2LMM_189721 CCCGGCTGGAAGAAGTATA Mature Antisense for V2LMM_189721 TATACTTCTTCCAGCCGGG Hairpin sequence for V2LMM_121057 TGCTGTTGACAGTGAGCG CGCCGCCCGGCTGGAAGAAGTA TAGTGAAGCCACAGATGTA TACTTCTTCCAGCCGGGCGGCA TGCCTACTGCCTCGGA Mature Sense for V2LMM_121057 CCGCCCGGCTGGAAGAAGT Mature Antisense for V2LMM_121057 ACTTCTTCCAGCCGGGCGG Hairpin sequence for V2LMM_210950 TGCTGTTGACAGTGAGCG AGGAATACTACTTCAATCACAT TAGTGAAGCCACAGATGTA ATGTGATTGAAGTAGTATTCCC TGCCTACTGCCTCGGA Mature Sense for V2LMM_210950
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.
Ask a homework question - tutors are online