recitation5 - 15-100 RECITATION 5 - FALL 2007A DNA sequence...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: 15-100 RECITATION 5 - FALL 2007A DNA sequence can be represented as a string containing the letters A, C, T, and G in some order. Computational biologists develop algorithms to analyze these DNA sequences for various patterns to learn more about the underlying DNA and its properties. Here is a random 60-letter DNA sequence: CTAATGGCATTATAGGGTGCCGGCGTGTCGGATATTCGGGGGATAGTGCTTAGTGAGCAT Exercise Download the DNAComputer.zipfile from the Recitation area of our course website. Move this folder into your Workspace and open up this project in Eclipse. This program starts by generating a random DNA sequence for you using a static method makeRandomDNA. Compile and run the program and look at the first lines of output to see the random sequence that is generated. Run it a few times to see how this sequence changes each time. Make sure you understand how makeRandomDNAworks. 1. The complement of a DNA sequence is a new sequence formed based on the original sequence with each 'A' becoming a 'T', each 'T' becoming an 'A', each 'C' becoming a 'G', and...
View Full Document

This note was uploaded on 01/25/2010 for the course CS 15100 taught by Professor Tom during the Fall '07 term at Carnegie Mellon.

Ask a homework question - tutors are online