lecture notes - ATTGGTGCATTACTTCGGCTCT...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
How many dif DNA molecules 10 nucleotide pairs long are possible 4^10 If the G+C content of a DNA samples is 48%, what are the proportions of all nucleotides? 24% G, 24% C, 26% A, 26% T A certain segment of DNA has the following nucleotide sequence in one strand
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: ATTGGTGCATTACTTCGGCTCT TAACCACGTAAtGAAGCCGAGA Forward genetics stats with observed variation in morphology or physiology (phenotype). First step is to search for a genetic difference that causes a phenotypic difference....
View Full Document

This note was uploaded on 01/26/2010 for the course GENETICS 380 taught by Professor Glodowski during the Fall '08 term at Rutgers.

Ask a homework question - tutors are online