{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

lecture notes - Forward genetics – stats with observed...

Info icon This preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
How many dif DNA molecules 10 nucleotide pairs long are possible 4^10 If the G+C content of a DNA samples is 48%, what are the proportions of all nucleotides? 24% G, 24% C, 26% A, 26% T A certain segment of DNA has the following nucleotide sequence in one strand
Image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: ATTGGTGCATTACTTCGGCTCT TAACCACGTAAtGAAGCCGAGA Forward genetics – stats with observed variation in morphology or physiology (phenotype). First step is to search for a genetic difference that causes a phenotypic difference....
View Full Document

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern