All Quiz 3 Questions 092309

All Quiz 3 Questions 092309 - Question 1 a. (1 point) You...

Info iconThis preview shows pages 1–4. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Question 1 a. (1 point) You are working in a mouse lab and are giving a tour to your friend who works on fruit flies. Your friend is surprised when you tell her that there are four Hox clusters in mice, because there is only one cluster in flies. What is your explanation for why there are four mouse Hox clusters? b. (1 point) You take the 11 th gene in the fly Hox cluster and BLAST it against the mouse genome. You find 4 genes in the mouse genome that are highly homologous to the fly sequence. Because one is in each Hox cluster, you term these genes Hoxa11 , Hoxb11 , Hoxc11 , and Hoxd11 . You look by in situ hybridization to see where the 4 Hox11 genes are expressed. You find that Hoxa11 , Hoxc11 , and Hoxd11 are expressed in a stripe near the pelvis, but Hoxb11 is not expressed anywhere in the mouse. Upon further inspection you find a nonsense mutation in Hoxb11 . What term best applies to Hoxb11 ? c. (3 points) You want to identify the enhancer that causes Hoxa11 to be expressed in a stripe near the pelvis. You identify a 450 base pair region of DNA downstream of Hoxa11 that is highly conserved across all vertebrates. Design an experiment to test the hypothesis that this region is the stripe enhancer. State your expected result. Question 1 a. (2 points) You are working for the Butterball Turkey Company. You want to minimize the effort spent plucking turkey feathers, so you decide to study a wild strain of turkey that lacks feathers. You hypothesize that a difference in expression of a gene called fea2 is responsible for the lack of feathers. Name 2 techniques you could use to detect expression of fea2 in developing turkeys. Indeed, you find that fea2 is expressed in spots in the developing turkey skin in wildtype, feathered turkeysbut not in featherless turkeys. You next perform an array Comparative Genomic Hybridization (aCGH) experiment. You label DNA from the featherless strain with a red probe, and label DNA from the wildtype strain with a green probe. You mix the labeled DNAs together and add them to a chip containing genomic DNA clones. You detect an interesting pattern downstream of the fea2 coding region: b. (1 point) What type of mutation is present in the featherless strain? c. (2 points) Propose a hypothesis that explains the featherless phenotype. Question 2 You are working on sequencing a new organisms genome: the Giraffe. You have sequenced reads and assembled them into contigs. Only one DNA strand from each contig is shown below in the 5 to 3 direction. Contig 1: 5 AGTCTCAGCTGATGCGAATTGTCGTCCGCGAGAAATTCGC 3 Contig 2: 5 TCATGATCTAGATCTACTTCATCTGAAGTCGATCGC 3 Contig 3: 5 GCACTGCTAGCTGTTAAGCTGATGGCTAGTCGAATCGATG 3 Now that you have contigs you would like to assemble these into scaffolds, so you use the information that you obtained from paired-end sequencing, shown below. The sequence on either side of the gap represents one of the two paired-end sequences: Paired-end read #1: 5 CGAATCGATGATGCTGATC..Gap..CAGTCATGCTAGTCTCAGCTG 3 5 CGAATCGATGATGCTGATC....
View Full Document

Page1 / 13

All Quiz 3 Questions 092309 - Question 1 a. (1 point) You...

This preview shows document pages 1 - 4. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online