termsEvolution+of+Genes+and+Genomes

termsEvolution+of+Genes+and+Genomes - dN/dS ratio or Exon...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
CGGCTGTCATCACTTAGACCTCACCCTGTGGAGCCA CACCCTAGGGTTGGCCAATCTACTCCAGGAGCAGG GAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGG GCAGAGCCATCTATTGCTTACATTTGCTTCTGACACG Terms Synonymous site Non-synonymous site Functional density isfolding ypothesis Paralog Gene family Whole genome duplication bfunctionalization Misfolding hypothesis
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: dN/dS ratio or Exon shuffling Ortholog Subfunctionalization Neofunctionalization Concerted Evolution Gene conversion CGGCTGTCATCACTTAGACCTCACCCTGTGGAGCCA CACCCTAGGGTTGGCCAATCTACTCCAGGAGCAGG GAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGG CAGAGCCATCTATTGCTTACATTTGCTTCTGACACG...
View Full Document

This note was uploaded on 01/31/2010 for the course EEB 390 taught by Professor Staff during the Winter '08 term at University of Michigan.

Ask a homework question - tutors are online