L6_OneDyeGeneExp

L6_OneDyeGeneExp - ECEN 689 Statistical Computation in GSP

Info iconThis preview shows pages 1–20. Sign up to view the full content.

View Full Document Right Arrow Icon
ECEN 689 Statistical Computation in GSP http://www.ece.tamu.edu/~ulisses/ECEN689/ Lecture 6: One-Dye Gene-Expression Microarrays Ulisses Braga Neto Genomic Signal Processing Laboratory Department of Electrical and Computer Engineering Texas A&M University
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Gene-Expression Microarray • Three main gene-expression microarray technologies: – cDNA, ~400-base cloned probes (old) – One-color oligonucleotide, 25-base sequenced probes (Affymetrix) – Two-color oligonucleotide, 25- to 60-base sequenced probes (Agilent, Amersham)
Background image of page 2
Affymettrix GeneChip
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Photolithographic Process Lamp Mask Wafer
Background image of page 4
Probe Synthesis HO HO O O O Light (deprotection) Mask O O O O O Substrate Light (deprotection) T T O O O T T O O O T – T T C C O C – C A T A T A G C T G T T C C G Continue
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Feature Size Features/Chip 100 μm 50 μm 24 μm 20 μm 18 μm 11 μm 16,384 65,538 284,444 409,600 506,944 >1,350,000 Genes/Chip 409 1,638 7,111 12,800 22,500 54,000 High-Density Chips For fixed array size, 1.28 x 1.28 cm
Background image of page 6
Probe Array Overview * * * * * *
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Human Whole Genome Arrays • HG-U133 2.0 Plus - 11um features - 54000 probe sets (probes have a 3’ end bias) - 6500 more genes than U133 set - entire content on one chip • Human Gene 1.0 ST Array - 5 um features - 28869 probe sets (probes spread through gene)
Background image of page 8
Gene Sequence Multiple 25-mer oligo probes
Background image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Perfect Match (PM) Mismatch (MM) Probe Pair Probe Set TACGACCGCTAATCGTAAATGTCAG TACGACCGCTAA A CGTAAATGTCAG
Background image of page 10
Assay Overview Process Control
Background image of page 11

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Poly-A control kit Manufactured by Ambion for Affymetrix Poly-A Control Stock: Lys, Phe, Thr, and Dap at staggered concentrations (i.e. complexity ratios). • Lys at 1:100,000 • Phe at 1:50,000 • Thr at 1:25,000 • Dap at 1:7,500 Poly-A Control Dilution Buffer Product Insert contains dilution instructions Material sufficient for about 100 reactions
Background image of page 12
Target Amplification One or two-cycle target amplification
Background image of page 13

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
One-cycle cDNA Synthesis
Background image of page 14
Two-cycle cDNA Synthesis
Background image of page 15

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Sample Cleanup and IVT
Background image of page 16
In Vitro Transcription Kit Proprietary biotinylated nucleotide analog Ambion Megascript based Start with as low as 1ug total RNA 30 reactions Over night incubation or 4hr with enzyme spike-in
Background image of page 17

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Hybridization/Scanning Scanned Image Scan Scanner Wash & Stain Fluidics Station Hybridize Hybridization Oven
Background image of page 18
• .DAT : Raw scanned images (big) Each probe cell corresponds to a square of 64x64 pixels • .CEL : Summarizes the info in the .DAT image by one single value (average intensity) for each probe cell. Much smaller file and point of start of most analyses. • .CDF : Specific to each chip, contains addressing info for each probe set. • .CHP : contains summary information of the probe sets, including intensity values. • .EXP
Background image of page 19

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 20
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 02/08/2010 for the course ECEN 689-601 taught by Professor Staff during the Spring '10 term at Texas A&M.

Page1 / 71

L6_OneDyeGeneExp - ECEN 689 Statistical Computation in GSP

This preview shows document pages 1 - 20. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online