Lecture14CMFall2009FINAL - MCB 250 Lecture 14 Transcription...

Info iconThis preview shows pages 1–12. Sign up to view the full content.

View Full Document Right Arrow Icon
MCB 250 Lecture 14 Transcription in Prokaryotes
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Convention and Nomenclature 5’ 5’ 3’ 3’ Template Strand Non-template Strand RNA +1 Start site of transcription P-P-P- 5’ CCGGCTCGTATAATAGACAGAATTGATGCGTA AAUUGAUGCGUA Non-template Strand RNA 5’ 5’ +1 -10
Background image of page 2
E. coli DNA Dependent RNA Polymerase Holoenzyme α 2 ββ ϖσ Core Polymerase α 2 ββ ϖ Capable of performing the enzymatic function Interacts with a series of auxiliary proteins that provide regulation that can occur at all steps of transcription The σ Subunit Required for recognition of the “promoter” There are 7 different σ ’s in E. coli that allow for recognition of different promoter sequences σ 70 is the “housekeeping” σ - most of the transcripts in E. coli are made by σ 70 polymerases.
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
RNA polymerase β 150 kD β ’ 155 kD (2 of the largest proteins in E. coli ) α 37 kD ϖ 10 kD ( involved in assembly, not required for activity) σ 70 70kD. Other σ ’s have different M.W.’s.
Background image of page 4
RNA Polymerase Transcription Bubble ~17 nucleotides RNA-DNA Hybrid ~9 basepairs Site of Nucleotide Addition Note that the transcription bubble is contained within the protein
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Structure of Prokaryotic RNA Polymerase β (blue) β ’ (purple) α (green) α (yellow ) ϖ (red) Active site Mg 2+ Text Fig. 12-2 RNA polymerase core enzyme α 2 ββ ϖ
Background image of page 6
Text Fig. 12-8 T = template strand NT = nontemplate strand “Channels” in RNA polymerase
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Clicker Question +1 indicates the start site of transcription. How many “+1’s” are there in the chromosome? A. 1 B. A few C. Thousands 5’ 5’ 3’ 3’ Template Strand Non-template Strand RNA +1 Start site of transcription P-P-P- 5’
Background image of page 8
The Promoter The promoter is the site in DNA where RNA polymerase binds. We define “the promoter” as the entire region on the DNA required for appropriately regulated transcription initiation. This includes all binding sites for regulatory proteins.
Background image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Conserved Sequences in Promoters Fig 12-5
Background image of page 10
σ Subunit Recognizes and Binds to the Promoter Comparison of a large number of promoter regions yields a “consensus sequence” for recognition by the main σ factor ( σ 70 ). Note that these sequences are on one “face” of the helix
Background image of page 11

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 12
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 02/17/2010 for the course MCB MCB 250 taught by Professor Miller during the Fall '09 term at University of Illinois at Urbana–Champaign.

Page1 / 34

Lecture14CMFall2009FINAL - MCB 250 Lecture 14 Transcription...

This preview shows document pages 1 - 12. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online