sept 27 transcription lecture

sept 27 transcription lecture - Transcription RNA...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
1 Transcription • RNA polymerase catalyzes transcription • Promoters signal RNA polymerase where to begin transcription • RNA polymerase adds nucleotides in 5 to 3 direction • Terminator sequences tell RNA when to stop transcription ORF Reading the genetic code ATGAACTATGCGCCGGAGC T AGCGCAT Met - Asn - Tyr - Ala - Pro - Glu - Leu - Ala - His TACT T GATACGCGGCCTCG A T CGCGTA 5 5 3 3 Met - Arg - STOP TACTGGTCTA ATGAACTATGCGCCGGAGCTAGCGCAT ACT TTACTGCT ATGACCAGAT TACTTGATACGCGGCCTCGATCGCGTA TGAAATGACGA 5 5 3 3 Open reading frame ORF ATGAACTATGCGCCGGAGC T AGCGCAT TACT T GATACGCGGCCTCG A TCGCGTA RNA-like strand Template strand TACT T GATACGCGGCCTCG A TCGCGTA AUGAACUA mRNA (5 to 3 ) Effect of mutations: ATGAACTATGCGCCGGAGC T AGCGCAT Met - Asn - Tyr - Ala - Pro - Glu - Leu - Ala - His C CCG and CCC both specify proline This is a silent mutation Effect of mutations: ATGAACTATGCGCCGGAGC T AGCGCAT Met - Asn - Tyr - Ala - Pro - Glu - Leu - Ala - His T CCG CTC changes proline
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

Page1 / 5

sept 27 transcription lecture - Transcription RNA...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online