
Biol223_Smith_12_2004-2005Spring_Final - Biol223_Smith...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Biol223_Smith FINAL 10 June 2005 PAGE 1 of 8 Exam # Biology 223 Spring 2005 FINAL, 10 June 2005 EXAM COPY # No notes, no calculators, no phones. Write your name and student ID number at the top of this page. Use non-erasable ink, write on the back if needed. Write legibly and succinctly, using proper terminology. Show your work and justify your conclusions, partial credit may awarded. State any important assumptions and indicate ambiguity. Negative points may be assigned to unjustified, frivolous, and grossly incorrect answers. 100 points possible each section Section I Russell chapters 1, 2, 3, 4, 5, 6, 7, 19. Section II Russell chapters 8, 9, 10, 13, 14, 16. Section III Russell chapters 17, 18 Note points per question and spend your effort accordingly! codon chart Second base I II III
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Biol223_Smith FINAL 10 June 2005 PAGE 2 of 8 Exam # Section I Question 1 for 10 points An imaginary insect similar to Drosophila melanogaster has 6 pairs of chromosomes, but the male does not undergo crossing over during meoisis. a) How many genetically different gametes are possible from the male? b) Assuming sex determination is similar to mammals, what proportion of his gametes will be produce males? c) What proportion of his gametes contain only chromosomes of maternal origin? d) What proportion of his gametes contain only one chromosome of paternal origin? e) What proportion of his gametes will contain precisely two chromosomes of paternal origin? write your answer as the calculated number in the box. a b c d e Question 2 for 10 points Between which two stages of meiosis are nuclei with the normal 2N mass of DNA produced? Question 3 for 10 points The sequence of the trp operon has a sequence of four regions that can form three kinds of hairpins, 1+2 for pause, 2+3 for antitermination, 3+4 for termination. Regions 2 through 4 are underlined below. For region 3 , indicate those nucleotides that pair with region 2 (write a 2 above) and those nucleotides that pair with region 4 (write a 4 below). Then fill out the table for 2 and 4. Some head scratching may be involved. region 2 region 3 region 4 CGGGCAGUGUAU UCACCAUGCGUGCGUACCACG AUACCCAGCCCGCC UAAUGAGCGGGCU U A U A C C C A G C C C G C C 2 4 Question 4 for 10 points The sequence motif for the rho-independent termination hairpin loop is 5'-CUAAUGA-3'. It must be displayed as a 7 nt loop on a hairpin stem. a) In a random transcript, how frequently would you expect the loop sequence to occur? (express as once per so many nucleotides, just set up the math as the series of factors. b) If the loop sequence were actually 5'-CYAAURR-3', where Y means pyrimidine, and R means purine? c) If the loop sequence were actually 5'- CDARUHA -3', where D means any but C, and H means any but G? d) By what additional factor would the frequency decrease if the loop must be displayed as a hairpin having any
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 02/23/2010 for the course BIOL 223 taught by Professor Smithanddarwiche during the Spring '10 term at American University of Beirut.

Page1 / 8

Biol223_Smith_12_2004-2005Spring_Final - Biol223_Smith...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online