Biol223_Smith_13_2005-2006Fall_ExamI

Biol223_Smith_13_2005-2006Fall_ExamI -...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Biol223_smith_2005-2006fall_examI_Q&A.doc 18 November 2005 PAGE 1 of 4 Exam # Biology 223 Fall 2005-2006 Exam I 18 November 2005 IN CLASS EXAM COPY # No notes, no calculators, no phones. Write your name and student ID number at the top of this page. I prefer ink, write on the back if needed. Write legibly and succinctly, using proper terminology. If I cannot read or understand your answer, you may receive no credit. Show your work and justify your conclusions, partial credit may be awarded. State any important assumptions and indicate ambiguity. Negative points may be assigned to unjustified, frivolous, and grossly incorrect answers. 100 points possible Russell chapters 1, 2, 3, 4, 5, 6, 7, 8 Note points per question and spend your effort accordingly! codon chart Second base
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Biol223_smith_2005-2006fall_examI_Q&A.doc 18 November 2005 PAGE 2 of 4 Exam # Question 1 for 10 points Predict the relative Tm (melting temperature) of the following 5 DNA probes when bound to their perfectly complementary targets: A) AGGCTTGCGACCGCTAACGT B) ACGCTTACCACCGATAACCT C) AGGTCTAGGAGCGCCCACGT D) AGTCCTATGACGCATGAACT E) ACGCCAACGACAGCTAACGT low high Question 2 for 10 points The sequence of the lambda nut BoxB anti-termination loop is 5'-GGAAA-3'. It must be displayed as a 5 nt loop on a hairpin stem. a) In a random RNA transcript, how frequently would you expect the loop sequence to occur? (express as once
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 02/23/2010 for the course BIOL 223 taught by Professor Smithanddarwiche during the Spring '10 term at American University of Beirut.

Page1 / 4

Biol223_Smith_13_2005-2006Fall_ExamI -...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online