Biomolecules_Ch5

Biomolecules_Ch5 - Chapter 5: biomolecules 5 major classes...

Info iconThis preview shows pages 1–20. Sign up to view the full content.

View Full Document Right Arrow Icon
Chapter 5: biomolecules 5 major classes Carbohydrates Proteins Nucleic acids Lipids Small molecules
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Thymine is a component of: 1. Fatty acids 2. Lipids 3. Carbohydrates 4. Nucleotides 5. Proteins
Background image of page 2
Formation of polymers Polymers Monomers; dimers, etc. Condensation reactions (in biochemistry) coupling (synthesis) by dehydration can be reversed by hydrolysis An immense number of polymers can be made from a limited set of monomers
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 4
Carbohydrates (saccharides) Sugars; Structural, nutritive, storage Typically a hydrate of carbon: – C 6 H 12 O 6 , or (CH 2 O) 6 Usually asymmetric (“optically active”) Notation is complex: ketose vs aldose number of carbons
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 6
Monosaccharides , particularly glucose, are the major fuel for cellular work. Also the raw material for synthesis of other monomers: amino acids, fatty acids. Almost always cyclize to form rings.
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 8
There are two possible ring structures for glucose: alpha and beta These differ in the orientation of the hydroxyl group attached to C1.
Background image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Disaccharides: glycosidic linkage, formed by dehydration. Maltose (malt sugar, a homo dimer) is formed by joining two glucose molecules. Sucrose (table sugar, a hetero dimer) is formed by joining glucose and fructose.
Background image of page 10
Starch is a polysaccharide of α -glucose monomers.
Background image of page 11

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
2200 β linkages occur also: Cellulose is a major component of the plant cell wall.
Background image of page 12
Background image of page 13

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 14
Background image of page 15

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Nucleic Acids - Informational Polymers 1.Nucleic acids store and transmit hereditary information 2.Inheritance is based on replication of the DNA double helix 3.We can use DNA and proteins as tape measures of evolution 4.There are two types of nucleic acids: ribonucleic acid (RNA) and deoxyribonucleic acid (DNA).
Background image of page 16
polymers of monomers called nucleotides. Each nucleotide consists of three parts: a nitrogen base, a pentose sugar, and a phosphate group. DNA vs. RNA deoxyribose vs. ribose thymine vs. uracil Nucleic acids
Background image of page 17

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 18
Base sequences in the genome of Anopheles gambiae R. A. Holt et al.; Science 298 , 129 (2002) Chromosome No. of bases 2L 48,795,086 2R 62,725,911 3L 41,284,009 3R 53,272,125 X 22,145,176 unknown 59,568,033 Total bases 287,790,340 chr2l Bases 224000 - 230000 CTTAAATCATATGGTCTTTCTCGTTTTCTCGTGAGATGCCGAATAATCCGTGAATATTTC ATTCAATCCGTAGCAATTCATTCGAGGGCTGCAGAATGAGATGGAATTGTCCTCTTGGGA TGTTGAATGTGCTGTCTTAATATAGTTAGCCATCTCAATTGGTTACTTTCGTCGCCATTA ACAGTTATAAATCTAGAGTTTTCTTGTCTGTTTTGTTAACAATAATTGCAGAAGCGTGTT TTATCTATATTTTTGTTATGCAAGGCTCTGGCTCCTCTTATGAGTGTTTGTATATTTTAC AACAAATCGTGTAAGCTATCTTATAATTGATTCTCCTTAGCTGTTGTGAAAATAAAAAAA AAGTGAATTAAGTGAAAAACGCGTGTAAGGACTAGGAACGCGCAAACAATATTTCCGTTA TTAAATGGTAATGCATGCCAGGAAACCGCAACGTTTGCTAAGCGATGGGTAAATTTCTAT TTCACTTCCCTTGTATATCATAAATGCAGACATTCATACGGAAAAAAGATTTTAAACTAT TGAATCTTTAATTTTGATATTCAATCGATGTTTAAAACGTTATCTCTTAGGTGATTTCAT TTCTCAAAAAATATTGTCAAAATTTGTAAATGATATCAAAACGAGTTAATTTTGACGATC ATAAAATAACATATTAATGCAGTCGGATACATTTACGTTAATATACATATCGATATCCTT
Background image of page 19

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 20
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 47

Biomolecules_Ch5 - Chapter 5: biomolecules 5 major classes...

This preview shows document pages 1 - 20. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online