60. DNA lablecture STR 10

60. DNA lablecture STR 10 - 1 Bring laptop with wireless...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: 1 Bring laptop with wireless access to lab this week DNA Technology: population genetics and forensic applications DNA sequencing Multiplex PCR Forensic DNA markers: short tandem repeats Random match probability Paternity index determination- Each of the four ddNTP is labeled with a different ¡uorescent color- Reaction tube has all ingredients including low quantity of ddNTP- Fragments terminated randomly during elongation - Color of each fragment indicates base at which termination occurs Fluorescent sequence printout BLAST Exercise Courtesy of Erica Larson Dimeric repeat Trimeric repeat Tetrameric repeat Microsatellites Satellite DNA: repetitive DNA sequence showing different density after centrifugation 2 Short Tandem Repeat (STR)- Is sets of short, repeating DNA sequences- Repeat unit can range from 2 to 8 nucleotides- Sequences do not code for proteins- Selective neutral- Evolved probably due to replication error- Each locus has a variety of alleles found in the population e.g., TH01: Repeating unit “AATG” ranges from 4 to 11 times in human population Short Tandem Repeat (STR) as Marker GCGAAGTTCCG AATGAATGAATGAATGAATGAATGAATG CCGCATT 7 repeats !! More than 20 loci are routinely used in forensics Feld. D5 and CS¡1PO physically linked but not genetically linked CODIS = Combined DNA Index System Marker region Polymerase Chain Reaction selects a portion of genome to make copies DNA An in vitro reaction (cell-free) Required materials - template: the DNA sequence to be copied- dNTPs (dATP, dGTP, dCTP, and dTTP) as building blocks- primers: short DNA sequences (19-33 bases in STRs) complementary to the template to start the reaction...
View Full Document

This note was uploaded on 03/13/2010 for the course BIOG 1102 taught by Professor Robertturgeo during the Spring '10 term at Cornell.

Page1 / 7

60. DNA lablecture STR 10 - 1 Bring laptop with wireless...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online