Sequencing-Pyrosequencing

Sequencing-Pyrosequencing - 3/4/10 DNA Sequencing To...

Info iconThis preview shows pages 1–5. Sign up to view the full content.

View Full Document Right Arrow Icon
3/4/10 1 DNA Sequencing To determine the order of nucleotides in DNA (genome), which tells you: 1. gene content 2. where gene regulatory elements are 3. where genes are 4. what they encode e.g. what proteins they encode, their regulatory elements, start sites, order of amino acids, and end sites. DNA Sequencing ------------------------------------------------------------------------ In the old days, there were two competing methods of determining DNA sequence: Maxam - Gilbert Method , in which a DNA sequence is end-labeled with [ 32 P] phosphate and chemically cleaved to leave a signature pattern of bands. Sanger Method , in which a DNA sequence is annealed to an oligonucleotide primer, which is then extended by DNA polymerase using a mixture of dNTP and ddNTP (chain terminating) substrates. Most modern sequencing equipment uses the principles of the Sanger technique.
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
3/4/10 2 The Sanger Technique Uses dideoxynucleotides (dideoxyadenine, dideoxyguanine, etc) These are molecules that resemble normal nucleotides but lack the 3’-OH group on the ribose. The Sanger method requires Multiple copies of single stranded template DNA A suitable primer (a small piece of DNA that can pair with the template DNA to act as a starting point for replication) DNA polymerase (an enzyme that copies DNA, adding new nucleotides to the 3’ end of the template) A ‘pool’ of normal nucleotides A small proportion of dideoxynucleotides labeled in some way ( radioactively or with fluorescent dyes)
Background image of page 2
3/4/10 3 The template DNA pieces are replicated, incorporating normal nucleotides, but occasionally and at random dideoxy (dd) nucleotides are incorporated. This stops ( terminates ) replication on that piece of DNA The result is a mix of DNA lengths , each ending with a particular labeled dd-nucleotide. Because DNA molecules of various length ‘travel’ at different rates during electrophoresis, the order of nucleotides ( sequence of nucleotides ) can be determined. Sanger Method (Dideoxynucleotide chain termination) Here's an example of how one goes about sequencing by this method. First, anneal the primer to the DNA template (usually single stranded): Primer 5’ GAATGTCCTTTC 3’ 3’–GGAGACTTACAGGAAAGAGATTCAGGATTCAGGAGGCCTACCATGAAGATCAAG‐5’ Template
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
3/4/10 4 Then split the sample into four aliquots, in tubes labeled "G", "A", "T" and "C" and add the following substrates to the respective
Background image of page 4
Image of page 5
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 03/16/2010 for the course BIO 362 taught by Professor Walikarzai during the Spring '10 term at SUNY Stony Brook.

Page1 / 21

Sequencing-Pyrosequencing - 3/4/10 DNA Sequencing To...

This preview shows document pages 1 - 5. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online