probset_5_2009

probset_5_2009 - 5 The following represents the nucleotide...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
BMB 100A Problem Set #5 Fall 2009 Name___________________ 1. What are two reasons that eukaryotic chromosomes contain telomeres? 2. To study genes at the molecular level, it is often important to obtain large quantities of DNA containing a purified gene. List two fundamentally different ways of accomplishing this. 3. Which steps of recombination require ATP? 4. During the original studies on isolation of RNA polymerase, why did extensive purification of RNA polymerase give preparations that were found to transcribe DNA inefficiently and non-specifically?
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: 5. The following represents the nucleotide sequence of one strand of a DNA duplex near the start of transcription of a highly transcribed E. coli gene. Identify (by boxing): (a) The –10 promoter element (Pribnow Box) (b) The –35 promoter element (c) The likely transcriptional start site (i.e., nucleotide #1 of the RNA transcript) (5’) TCAGAAAATTATTTTAAATTTCCTCTTGTCAGGCCGGA ATAACTCCCTATAATGCGCCACCACTGACACGG (3’) 6. How was it shown that the genetic code is (a) “comma-less” and (b) non-overlapping?...
View Full Document

This note was uploaded on 03/16/2010 for the course BIOC 100A taught by Professor Harrynoller during the Winter '10 term at UCSC.

Ask a homework question - tutors are online