14-DNAreplicationnotes

14-DNAreplicationnotes - DNAreplication...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
DNA replication Duplication of genetic material - Basic function of genetic material requires accurate replication - Watson and Crick noticed that their proposed structure allows for a mechanism of replication o Uses principle of complementarity Possible models for DNA replication: see figure 14.11 o Conservative mechanism:  original strands stay together, both strands are retained,  second copy is completely new o Semiconservative: one strand is new, one strand is old o Dispersive: both strands of both new helices are a mix/mosaic of old and new Meselson-Stahl experiment - Showed that DNA replication was semi-conservative Semiconservative  - Semiconservative replication means that each strand is copied o Produces a new complementary strand o Conserves one “old” strand in new duplexes - Uses the principle of complementary base pairing: depends on H-bonding patterns of bases 5’ ATGCCGTTACGAATTCTGCTA 3’ 3’ TACGGCAATGCTTAAGACGAT 5’ Basic Mechanism - Open up helix - Copy each strand - Produces 2 new strands that are each hybrids of new and old strands - In new helix, one strand is old, one strand is new Requirements for replication - What do we need to replicate DNA? 1. Template: DNA to copy 2. Monomers: nucleotides, building blocks of DNA 3. Enzyme: DNA Polymerase, helps copy DNA
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
4. Open helix: helicase 5. Torsional strain: topoisomerase (gyrase) - More as we see how process works DNA polymerases - First one found in 
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 6

14-DNAreplicationnotes - DNAreplication...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online