PROBLEM_SET_2.466n_

PROBLEM_SET_2.466n_ - that the mutant resulted from a single base change in the DNA encoding the gene what mutation took place at the DNA level and

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Genetics 466 Fall 2008 Sean Carroll 1 PROBLEM SET #2 (lectures 17-18) 1. Understand the following terms involved in transcription and translation of the genetic code aminoacyl tRNA wobble elongation factors codon reading frame release factors anticodon peptide bond amino acid ribosome P site rRNA initiation codon A site mRNA stop codons GTP tRNA puromycin frameshift inosine RNA polymerase 2. A portion of the DNA sequence encoding a particular gene has the sequence: 3’ GGACCCTACAAACGCGGGGAACCACAAACATCGGG 5’ What is the sequence of the mRNA it encodes? What is the sequence of the polypeptide it encodes if an initiation codon is needed to begin polypeptide synthesis? What would the sequence be if the A (boxed) was mutated to a T? 3. A protein is found with the sequence Met-Thr-Trp-Phe-Lys-Cys-Arg-His-Pro- Gly. A mutant is found with the sequence Met-Thr-Trp-Phe-Lys. What are all of the possible mRNA sequences that could encode this protein. Assuming
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 2
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: that the mutant resulted from a single base change in the DNA encoding the gene, what mutation took place at the DNA level and how did that affect the mRNA and protein sequence? 4. The mRNA for a particular protein is unusual in that it lacks any cytosine residues. What amino acids might it contain and which ones could it not possess? Genetics 466 Fall 2008 Sean Carroll 2 5. Tryptophan is a relatively rare amino acid in proteins, can you think of one reason why? 6. Four different codons encode the amino acid glycine. Taking into account wobble rules, how many tRNAs are necessary for glycine and what might their anticodon sequences be? 7. A pathogenic bacterium is found that is newly resistant to puromycin. What is the likely cause of this resistance? 8. You’ve isolated the messenger RNA for one gene but don’t know which strand of DNA serves as a template for transcription. How would you find out?...
View Full Document

This note was uploaded on 03/26/2010 for the course GENETICS 466 taught by Professor Staff during the Fall '08 term at Wisconsin.

Page1 / 2

PROBLEM_SET_2.466n_ - that the mutant resulted from a single base change in the DNA encoding the gene what mutation took place at the DNA level and

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online