{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

PROBLEM_SET_2.466n_ - that the mutant resulted from a...

Info icon This preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Genetics 466 Fall 2008 Sean Carroll 1 PROBLEM SET #2 (lectures 17-18) 1. Understand the following terms involved in transcription and translation of the genetic code aminoacyl tRNA wobble elongation factors codon reading frame release factors anticodon peptide bond amino acid ribosome P site rRNA initiation codon A site mRNA stop codons GTP tRNA puromycin frameshift inosine RNA polymerase 2. A portion of the DNA sequence encoding a particular gene has the sequence: 3’ GGACCCTACAAACGCGGGGAACCACAAACATCGGG 5’ What is the sequence of the mRNA it encodes? What is the sequence of the polypeptide it encodes if an initiation codon is needed to begin polypeptide synthesis? What would the sequence be if the A (boxed) was mutated to a T? 3. A protein is found with the sequence Met-Thr-Trp-Phe-Lys-Cys-Arg-His-Pro- Gly. A mutant is found with the sequence Met-Thr-Trp-Phe-Lys. What are all of the possible mRNA sequences that could encode this protein. Assuming
Image of page 1

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: that the mutant resulted from a single base change in the DNA encoding the gene, what mutation took place at the DNA level and how did that affect the mRNA and protein sequence? 4. The mRNA for a particular protein is unusual in that it lacks any cytosine residues. What amino acids might it contain and which ones could it not possess? Genetics 466 Fall 2008 Sean Carroll 2 5. Tryptophan is a relatively rare amino acid in proteins, can you think of one reason why? 6. Four different codons encode the amino acid glycine. Taking into account wobble rules, how many tRNAs are necessary for glycine and what might their anticodon sequences be? 7. A pathogenic bacterium is found that is newly resistant to puromycin. What is the likely cause of this resistance? 8. You’ve isolated the messenger RNA for one gene but don’t know which strand of DNA serves as a template for transcription. How would you find out?...
View Full Document

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern